\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000904013:

Variant ID: vg1000904013 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 904013
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGTTGACCTACGGTATAAAAGGGACCCCCCGGGAGGACCTAAGGCATTAAATCTTAGAGCCAACACATCTACCACAGCCTACGAAGCCGGAGCTTATC[A/G]
AAGCCAGGTCGCCGGGAGATCTAGTCGGATCAACTCGACTACGATCCTGTCGGTATCATCGAGCTTTACTATTCCTTTTGTAATCTGTGGTTTCCATCAT

Reverse complement sequence

ATGATGGAAACCACAGATTACAAAAGGAATAGTAAAGCTCGATGATACCGACAGGATCGTAGTCGAGTTGATCCGACTAGATCTCCCGGCGACCTGGCTT[T/C]
GATAAGCTCCGGCTTCGTAGGCTGTGGTAGATGTGTTGGCTCTAAGATTTAATGCCTTAGGTCCTCCCGGGGGGTCCCTTTTATACCGTAGGTCAACTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 9.80% 0.70% 20.84% NA
All Indica  2759 66.40% 0.30% 0.29% 33.02% NA
All Japonica  1512 68.70% 29.20% 1.19% 0.93% NA
Aus  269 81.40% 0.40% 0.74% 17.47% NA
Indica I  595 55.30% 0.20% 0.67% 43.87% NA
Indica II  465 78.10% 0.60% 0.00% 21.29% NA
Indica III  913 67.90% 0.10% 0.11% 31.87% NA
Indica Intermediate  786 66.20% 0.40% 0.38% 33.08% NA
Temperate Japonica  767 43.80% 53.60% 2.22% 0.39% NA
Tropical Japonica  504 96.80% 1.80% 0.00% 1.39% NA
Japonica Intermediate  241 89.20% 8.70% 0.41% 1.66% NA
VI/Aromatic  96 92.70% 0.00% 1.04% 6.25% NA
Intermediate  90 75.60% 12.20% 4.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000904013 A -> G LOC_Os10g02470.1 upstream_gene_variant ; 335.0bp to feature; MODIFIER silent_mutation Average:43.187; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1000904013 A -> G LOC_Os10g02450-LOC_Os10g02470 intergenic_region ; MODIFIER silent_mutation Average:43.187; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1000904013 A -> DEL N N silent_mutation Average:43.187; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000904013 NA 2.16E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 3.11E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 7.70E-08 1.11E-32 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 3.65E-12 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 7.68E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 5.49E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 1.09E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 1.02E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 5.28E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 3.66E-09 7.99E-31 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 1.85E-12 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 1.25E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 3.75E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 7.39E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 2.36E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 1.38E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 5.92E-09 2.21E-35 mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 1.02E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 2.20E-11 1.19E-35 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 2.24E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 1.56E-06 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 2.13E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 9.79E-08 2.38E-19 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904013 NA 3.27E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251