\
| Variant ID: vg1000744795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 744795 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 113. )
TAACTAAAAATCAAGAGATAGATATTAATGCTATGTGATAGTTTGAGAGCGATTTTAGATTGCTACGTGGCGGTTTAGGAGCGTTTATAGCAAGTTTAAT[G/A]
GACTTTTAGTATATAATAGATAGATAAATAAATAGATATGGATAATGCTAAAAAGTCTTATAACAGTAGCAGCAGTAGTCTAGGTGCACTTCATTTAGGC
GCCTAAATGAAGTGCACCTAGACTACTGCTGCTACTGTTATAAGACTTTTTAGCATTATCCATATCTATTTATTTATCTATCTATTATATACTAAAAGTC[C/T]
ATTAAACTTGCTATAAACGCTCCTAAACCGCCACGTAGCAATCTAAAATCGCTCTCAAACTATCACATAGCATTAATATCTATCTCTTGATTTTTAGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 21.90% | 3.15% | 10.35% | NA |
| All Indica | 2759 | 59.60% | 31.00% | 2.94% | 6.42% | NA |
| All Japonica | 1512 | 72.90% | 2.70% | 4.17% | 20.17% | NA |
| Aus | 269 | 55.00% | 45.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 40.30% | 52.80% | 4.03% | 2.86% | NA |
| Indica II | 465 | 68.40% | 18.90% | 4.30% | 8.39% | NA |
| Indica III | 913 | 62.80% | 24.00% | 2.08% | 11.17% | NA |
| Indica Intermediate | 786 | 65.40% | 29.90% | 2.29% | 2.42% | NA |
| Temperate Japonica | 767 | 85.00% | 3.70% | 3.91% | 7.43% | NA |
| Tropical Japonica | 504 | 50.80% | 1.80% | 5.16% | 42.26% | NA |
| Japonica Intermediate | 241 | 80.90% | 1.70% | 2.90% | 14.52% | NA |
| VI/Aromatic | 96 | 92.70% | 5.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 11.10% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000744795 | G -> A | LOC_Os10g02170.1 | upstream_gene_variant ; 2120.0bp to feature; MODIFIER | silent_mutation | Average:31.811; most accessible tissue: Callus, score: 84.785 | N | N | N | N |
| vg1000744795 | G -> A | LOC_Os10g02180.1 | downstream_gene_variant ; 4607.0bp to feature; MODIFIER | silent_mutation | Average:31.811; most accessible tissue: Callus, score: 84.785 | N | N | N | N |
| vg1000744795 | G -> A | LOC_Os10g02170-LOC_Os10g02180 | intergenic_region ; MODIFIER | silent_mutation | Average:31.811; most accessible tissue: Callus, score: 84.785 | N | N | N | N |
| vg1000744795 | G -> DEL | N | N | silent_mutation | Average:31.811; most accessible tissue: Callus, score: 84.785 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000744795 | 2.35E-06 | 2.35E-06 | mr1385 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000744795 | NA | 6.05E-08 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |