| Variant ID: vg1000734158 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 734158 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTAAGCTTTCTAGGTTATTGATTTACGTAGTTGGAGAATGTCGCCCTCATGTCGTACTCGGTTTACTTAGGTCTCGGATGCGTCTCCCCCACCTCCACGA[T/C]
GGCAGAGGCTACTGACACTCGGCGAGAAGTAAGTGGACGAAATTTGAGGTTCTCGACTTGGTTGGATTTTGTCGTCTTGTTACGATGACCGACATGGCCG
CGGCCATGTCGGTCATCGTAACAAGACGACAAAATCCAACCAAGTCGAGAACCTCAAATTTCGTCCACTTACTTCTCGCCGAGTGTCAGTAGCCTCTGCC[A/G]
TCGTGGAGGTGGGGGAGACGCATCCGAGACCTAAGTAAACCGAGTACGACATGAGGGCGACATTCTCCAACTACGTAAATCAATAACCTAGAAAGCTTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.10% | 6.30% | 1.29% | 38.28% | NA |
| All Indica | 2759 | 55.10% | 1.60% | 1.67% | 41.68% | NA |
| All Japonica | 1512 | 52.50% | 5.40% | 0.73% | 41.40% | NA |
| Aus | 269 | 55.00% | 44.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 67.10% | 0.00% | 1.85% | 31.09% | NA |
| Indica II | 465 | 31.00% | 0.90% | 2.80% | 65.38% | NA |
| Indica III | 913 | 53.30% | 3.30% | 0.88% | 42.50% | NA |
| Indica Intermediate | 786 | 62.20% | 1.30% | 1.78% | 34.73% | NA |
| Temperate Japonica | 767 | 79.40% | 9.10% | 0.00% | 11.47% | NA |
| Tropical Japonica | 504 | 10.50% | 0.00% | 1.98% | 87.50% | NA |
| Japonica Intermediate | 241 | 54.80% | 4.60% | 0.41% | 40.25% | NA |
| VI/Aromatic | 96 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 14.40% | 2.22% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000734158 | T -> C | LOC_Os10g02150.1 | missense_variant ; p.Trp224Arg; MODERATE | nonsynonymous_codon ; W224R | Average:28.919; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | unknown | unknown | TOLERATED | 1.00 |
| vg1000734158 | T -> DEL | LOC_Os10g02150.1 | N | frameshift_variant | Average:28.919; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000734158 | 3.58E-08 | NA | mr1757 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000734158 | 5.63E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000734158 | 8.28E-10 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000734158 | 2.69E-07 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000734158 | 3.71E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000734158 | NA | 1.58E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |