\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000625785:

Variant ID: vg1000625785 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 625785
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAATGATTTAAAATTGTTAAAAATTCTAATAATCATATATAACTAACATATGCATGATATTAAATTGTTAAAAATTCTAATTAACCTATGTAAATACCA[C/T]
ATGCATGATTTAAAATTAATAAAAATTCTAATAATCATATATAATTAGCATATGCATGATATTAAATTGTTAAAAATTCTAATTAACATATGTAAATCCC

Reverse complement sequence

GGGATTTACATATGTTAATTAGAATTTTTAACAATTTAATATCATGCATATGCTAATTATATATGATTATTAGAATTTTTATTAATTTTAAATCATGCAT[G/A]
TGGTATTTACATAGGTTAATTAGAATTTTTAACAATTTAATATCATGCATATGTTAGTTATATATGATTATTAGAATTTTTAACAATTTTAAATCATTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 0.50% 7.87% 27.57% NA
All Indica  2759 65.10% 0.40% 7.36% 27.11% NA
All Japonica  1512 56.20% 0.70% 10.78% 32.34% NA
Aus  269 97.00% 0.00% 0.37% 2.60% NA
Indica I  595 65.70% 0.00% 5.04% 29.24% NA
Indica II  465 61.10% 0.90% 7.31% 30.75% NA
Indica III  913 63.40% 0.40% 9.86% 26.29% NA
Indica Intermediate  786 69.10% 0.40% 6.23% 24.30% NA
Temperate Japonica  767 81.60% 0.40% 2.74% 15.25% NA
Tropical Japonica  504 16.30% 1.40% 24.01% 58.33% NA
Japonica Intermediate  241 58.90% 0.00% 8.71% 32.37% NA
VI/Aromatic  96 64.60% 0.00% 2.08% 33.33% NA
Intermediate  90 64.40% 2.20% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000625785 C -> T LOC_Os10g01984.1 intron_variant ; MODIFIER silent_mutation Average:12.692; most accessible tissue: Zhenshan97 flag leaf, score: 17.069 N N N N
vg1000625785 C -> DEL N N silent_mutation Average:12.692; most accessible tissue: Zhenshan97 flag leaf, score: 17.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000625785 8.08E-06 8.07E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 6.33E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 3.46E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 3.13E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 1.74E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 1.31E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 2.89E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 7.61E-06 1.30E-12 mr1251 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 9.61E-08 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 5.40E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 9.84E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 3.65E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 6.46E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 1.36E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 1.54E-12 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 5.47E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 7.19E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 2.91E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 9.19E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 6.28E-08 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 4.45E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 7.86E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 2.87E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 1.40E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 8.66E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 4.41E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785 NA 3.57E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251