Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000625785:

Variant ID: vg1000625785 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 625785
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAATGATTTAAAATTGTTAAAAATTCTAATAATCATATATAACTAACATATGCATGATATTAAATTGTTAAAAATTCTAATTAACCTATGTAAATACCA[C/T]
ATGCATGATTTAAAATTAATAAAAATTCTAATAATCATATATAATTAGCATATGCATGATATTAAATTGTTAAAAATTCTAATTAACATATGTAAATCCC

Reverse complement sequence

GGGATTTACATATGTTAATTAGAATTTTTAACAATTTAATATCATGCATATGCTAATTATATATGATTATTAGAATTTTTATTAATTTTAAATCATGCAT[G/A]
TGGTATTTACATAGGTTAATTAGAATTTTTAACAATTTAATATCATGCATATGTTAGTTATATATGATTATTAGAATTTTTAACAATTTTAAATCATTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	0.50%	7.87%	27.57%	NA
All Indica	2759	65.10%	0.40%	7.36%	27.11%	NA
All Japonica	1512	56.20%	0.70%	10.78%	32.34%	NA
Aus	269	97.00%	0.00%	0.37%	2.60%	NA
Indica I	595	65.70%	0.00%	5.04%	29.24%	NA
Indica II	465	61.10%	0.90%	7.31%	30.75%	NA
Indica III	913	63.40%	0.40%	9.86%	26.29%	NA
Indica Intermediate	786	69.10%	0.40%	6.23%	24.30%	NA
Temperate Japonica	767	81.60%	0.40%	2.74%	15.25%	NA
Tropical Japonica	504	16.30%	1.40%	24.01%	58.33%	NA
Japonica Intermediate	241	58.90%	0.00%	8.71%	32.37%	NA
VI/Aromatic	96	64.60%	0.00%	2.08%	33.33%	NA
Intermediate	90	64.40%	2.20%	3.33%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000625785	C -> T	LOC_Os10g01984.1	intron_variant ; MODIFIER	silent_mutation	Average:12.692; most accessible tissue: Zhenshan97 flag leaf, score: 17.069	N	N	N	N
vg1000625785	C -> DEL	N	N	silent_mutation	Average:12.692; most accessible tissue: Zhenshan97 flag leaf, score: 17.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000625785	8.08E-06	8.07E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	6.33E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	3.46E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	3.13E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	1.74E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	1.31E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	2.89E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	7.61E-06	1.30E-12	mr1251	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	9.61E-08	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	5.40E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	9.84E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	3.65E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	6.46E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	1.36E-11	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	1.54E-12	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	5.47E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	7.19E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	2.91E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	9.19E-06	mr1603	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	6.28E-08	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	4.45E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	7.86E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	2.87E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	1.40E-09	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	8.66E-08	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	4.41E-10	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000625785	NA	3.57E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251