\
| Variant ID: vg1000621991 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 621991 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATGGTGCAGGAGGAGACGGCGAAGCCGGAGGAGATGGTGCACGAGACGCCGCTTGTCGCCCAGGGAGGATGATGTACCGCTTGCGCTATAGTATAATGGC[G/A]
TGCCTTGTGTCTCGTAGATGCGTCTCACCATCTCCTCCTAGGTAGTCCAACTCGAGGTCCTCGTACACGGCTTCCACCAGCTCAACTTCGACCCTCGAGT
ACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCTAGGAGGAGATGGTGAGACGCATCTACGAGACACAAGGCA[C/T]
GCCATTATACTATAGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTTCGCCGTCTCCTCCTGCACCAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 19.90% | 2.09% | 1.18% | NA |
| All Indica | 2759 | 97.50% | 1.00% | 1.49% | 0.00% | NA |
| All Japonica | 1512 | 45.70% | 50.30% | 0.40% | 3.64% | NA |
| Aus | 269 | 51.30% | 45.00% | 3.72% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.20% | 0.40% | 3.40% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 1.70% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 13.20% | 80.30% | 0.00% | 6.52% | NA |
| Tropical Japonica | 504 | 93.30% | 6.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.80% | 46.10% | 2.07% | 2.07% | NA |
| VI/Aromatic | 96 | 52.10% | 8.30% | 38.54% | 1.04% | NA |
| Intermediate | 90 | 66.70% | 27.80% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000621991 | G -> A | LOC_Os10g01984.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.698; most accessible tissue: Callus, score: 39.851 | N | N | N | N |
| vg1000621991 | G -> DEL | N | N | silent_mutation | Average:26.698; most accessible tissue: Callus, score: 39.851 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000621991 | 2.28E-16 | 2.16E-33 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 6.32E-08 | 3.09E-12 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 1.44E-13 | 1.22E-41 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 1.49E-06 | 2.55E-12 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 6.33E-20 | 4.58E-56 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 2.67E-07 | 3.66E-14 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 1.52E-08 | 5.57E-13 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 2.90E-06 | 2.27E-08 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 5.56E-19 | 1.01E-43 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 8.62E-09 | 9.57E-18 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 3.78E-07 | NA | mr1530_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | 1.13E-08 | 7.39E-19 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000621991 | NA | 4.32E-10 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |