\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000570465:

Variant ID: vg1000570465 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 570465
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCGAACTGCTTGCCGTTGTTAGTGATGAACTCTTTCGGCACTCCGAAACGGCATACAATGTTTTTCCATACAAACTTCTATACTACTGCCGAGGTGAT[C/T]
GCGCCGAGTGGTTCGGCCTCGATCCACCGGGAGAAGTATTCGACGGCCACAATTGCGAACTTCTACCCGTTTCGCGCCACCGGGAACGGCCCAATGATGT

Reverse complement sequence

ACATCATTGGGCCGTTCCCGGTGGCGCGAAACGGGTAGAAGTTCGCAATTGTGGCCGTCGAATACTTCTCCCGGTGGATCGAGGCCGAACCACTCGGCGC[G/A]
ATCACCTCGGCAGTAGTATAGAAGTTTGTATGGAAAAACATTGTATGCCGTTTCGGAGTGCCGAAAGAGTTCATCACTAACAACGGCAAGCAGTTCGACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 2.10% 0.95% 6.62% NA
All Indica  2759 96.40% 0.00% 0.07% 3.44% NA
All Japonica  1512 91.00% 5.90% 2.65% 0.46% NA
Aus  269 39.00% 0.00% 0.00% 60.97% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 99.40% 0.00% 0.00% 0.65% NA
Indica III  913 94.20% 0.00% 0.00% 5.81% NA
Indica Intermediate  786 94.90% 0.00% 0.13% 4.96% NA
Temperate Japonica  767 84.40% 11.10% 4.56% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 1.20% 2.07% 2.90% NA
VI/Aromatic  96 49.00% 9.40% 1.04% 40.62% NA
Intermediate  90 87.80% 1.10% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000570465 C -> T LOC_Os10g01880.1 downstream_gene_variant ; 645.0bp to feature; MODIFIER silent_mutation Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1000570465 C -> T LOC_Os10g01890.1 downstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1000570465 C -> T LOC_Os10g01900.1 downstream_gene_variant ; 4116.0bp to feature; MODIFIER silent_mutation Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1000570465 C -> T LOC_Os10g01880-LOC_Os10g01890 intergenic_region ; MODIFIER silent_mutation Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1000570465 C -> DEL N N silent_mutation Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000570465 6.00E-07 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 3.59E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 7.70E-06 NA mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 NA 9.92E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 1.89E-06 NA mr1671 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 NA 2.43E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 3.28E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 3.90E-10 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 NA 1.56E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 1.80E-07 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465 NA 1.77E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251