Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000570465:

Variant ID: vg1000570465 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 570465
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTCGAACTGCTTGCCGTTGTTAGTGATGAACTCTTTCGGCACTCCGAAACGGCATACAATGTTTTTCCATACAAACTTCTATACTACTGCCGAGGTGAT[C/T]
GCGCCGAGTGGTTCGGCCTCGATCCACCGGGAGAAGTATTCGACGGCCACAATTGCGAACTTCTACCCGTTTCGCGCCACCGGGAACGGCCCAATGATGT

Reverse complement sequence

ACATCATTGGGCCGTTCCCGGTGGCGCGAAACGGGTAGAAGTTCGCAATTGTGGCCGTCGAATACTTCTCCCGGTGGATCGAGGCCGAACCACTCGGCGC[G/A]
ATCACCTCGGCAGTAGTATAGAAGTTTGTATGGAAAAACATTGTATGCCGTTTCGGAGTGCCGAAAGAGTTCATCACTAACAACGGCAAGCAGTTCGACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	2.10%	0.95%	6.62%	NA
All Indica	2759	96.40%	0.00%	0.07%	3.44%	NA
All Japonica	1512	91.00%	5.90%	2.65%	0.46%	NA
Aus	269	39.00%	0.00%	0.00%	60.97%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	99.40%	0.00%	0.00%	0.65%	NA
Indica III	913	94.20%	0.00%	0.00%	5.81%	NA
Indica Intermediate	786	94.90%	0.00%	0.13%	4.96%	NA
Temperate Japonica	767	84.40%	11.10%	4.56%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	1.20%	2.07%	2.90%	NA
VI/Aromatic	96	49.00%	9.40%	1.04%	40.62%	NA
Intermediate	90	87.80%	1.10%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000570465	C -> T	LOC_Os10g01880.1	downstream_gene_variant ; 645.0bp to feature; MODIFIER	silent_mutation	Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1000570465	C -> T	LOC_Os10g01890.1	downstream_gene_variant ; 147.0bp to feature; MODIFIER	silent_mutation	Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1000570465	C -> T	LOC_Os10g01900.1	downstream_gene_variant ; 4116.0bp to feature; MODIFIER	silent_mutation	Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1000570465	C -> T	LOC_Os10g01880-LOC_Os10g01890	intergenic_region ; MODIFIER	silent_mutation	Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1000570465	C -> DEL	N	N	silent_mutation	Average:36.832; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000570465	6.00E-07	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	3.59E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	7.70E-06	NA	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	NA	9.92E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	1.89E-06	NA	mr1671	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	NA	2.43E-06	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	3.28E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	3.90E-10	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	NA	1.56E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	1.80E-07	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000570465	NA	1.77E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251