Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000524606:

Variant ID: vg1000524606 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 524606
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

GCCATGATCACTTCTATACCATAAATGTCAACAAAAATTATAGCTTTTGTGTACCATGAACTAGCTCTTGGCATAAATTAAAACAACTGATAGTCCTTCT[C/T]
GTTTGCAATACCTAATAAATCGACAATAAGAGGAAGAAATCTCCATAAAAATTGGAATTGAGAAAGACAATCTCATTTTTGACCATGATAAACTAAAGTA

Reverse complement sequence

TACTTTAGTTTATCATGGTCAAAAATGAGATTGTCTTTCTCAATTCCAATTTTTATGGAGATTTCTTCCTCTTATTGTCGATTTATTAGGTATTGCAAAC[G/A]
AGAAGGACTATCAGTTGTTTTAATTTATGCCAAGAGCTAGTTCATGGTACACAAAAGCTATAATTTTTGTTGACATTTATGGTATAGAAGTGATCATGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.70%	17.90%	22.39%	29.03%	NA
All Indica	2759	18.40%	22.10%	26.24%	33.24%	NA
All Japonica	1512	57.30%	1.10%	14.68%	26.85%	NA
Aus	269	8.90%	66.90%	18.96%	5.20%	NA
Indica I	595	32.90%	7.10%	26.72%	33.28%	NA
Indica II	465	10.30%	8.40%	28.39%	52.90%	NA
Indica III	913	12.80%	42.80%	21.14%	23.22%	NA
Indica Intermediate	786	18.60%	17.70%	30.53%	33.21%	NA
Temperate Japonica	767	88.40%	0.00%	4.56%	7.04%	NA
Tropical Japonica	504	13.70%	1.80%	27.78%	56.75%	NA
Japonica Intermediate	241	49.80%	3.30%	19.50%	27.39%	NA
VI/Aromatic	96	18.80%	36.50%	36.46%	8.33%	NA
Intermediate	90	36.70%	4.40%	28.89%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000524606	C -> T	LOC_Os10g01800.1	upstream_gene_variant ; 1541.0bp to feature; MODIFIER	silent_mutation	Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg1000524606	C -> T	LOC_Os10g01810.1	upstream_gene_variant ; 3717.0bp to feature; MODIFIER	silent_mutation	Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg1000524606	C -> T	LOC_Os10g01820.1	upstream_gene_variant ; 4822.0bp to feature; MODIFIER	silent_mutation	Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg1000524606	C -> T	LOC_Os10g01790.1	intron_variant ; MODIFIER	silent_mutation	Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg1000524606	C -> DEL	N	N	silent_mutation	Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000524606	NA	5.12E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	1.12E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	3.31E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	1.37E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	1.32E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	2.83E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	3.38E-06	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	6.53E-06	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	9.06E-06	2.49E-10	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	7.65E-11	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	2.58E-08	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	1.68E-07	2.24E-12	mr1203_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	1.08E-08	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606	NA	2.61E-08	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251