\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000524606:

Variant ID: vg1000524606 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 524606
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GCCATGATCACTTCTATACCATAAATGTCAACAAAAATTATAGCTTTTGTGTACCATGAACTAGCTCTTGGCATAAATTAAAACAACTGATAGTCCTTCT[C/T]
GTTTGCAATACCTAATAAATCGACAATAAGAGGAAGAAATCTCCATAAAAATTGGAATTGAGAAAGACAATCTCATTTTTGACCATGATAAACTAAAGTA

Reverse complement sequence

TACTTTAGTTTATCATGGTCAAAAATGAGATTGTCTTTCTCAATTCCAATTTTTATGGAGATTTCTTCCTCTTATTGTCGATTTATTAGGTATTGCAAAC[G/A]
AGAAGGACTATCAGTTGTTTTAATTTATGCCAAGAGCTAGTTCATGGTACACAAAAGCTATAATTTTTGTTGACATTTATGGTATAGAAGTGATCATGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.70% 17.90% 22.39% 29.03% NA
All Indica  2759 18.40% 22.10% 26.24% 33.24% NA
All Japonica  1512 57.30% 1.10% 14.68% 26.85% NA
Aus  269 8.90% 66.90% 18.96% 5.20% NA
Indica I  595 32.90% 7.10% 26.72% 33.28% NA
Indica II  465 10.30% 8.40% 28.39% 52.90% NA
Indica III  913 12.80% 42.80% 21.14% 23.22% NA
Indica Intermediate  786 18.60% 17.70% 30.53% 33.21% NA
Temperate Japonica  767 88.40% 0.00% 4.56% 7.04% NA
Tropical Japonica  504 13.70% 1.80% 27.78% 56.75% NA
Japonica Intermediate  241 49.80% 3.30% 19.50% 27.39% NA
VI/Aromatic  96 18.80% 36.50% 36.46% 8.33% NA
Intermediate  90 36.70% 4.40% 28.89% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000524606 C -> T LOC_Os10g01800.1 upstream_gene_variant ; 1541.0bp to feature; MODIFIER silent_mutation Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1000524606 C -> T LOC_Os10g01810.1 upstream_gene_variant ; 3717.0bp to feature; MODIFIER silent_mutation Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1000524606 C -> T LOC_Os10g01820.1 upstream_gene_variant ; 4822.0bp to feature; MODIFIER silent_mutation Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1000524606 C -> T LOC_Os10g01790.1 intron_variant ; MODIFIER silent_mutation Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1000524606 C -> DEL N N silent_mutation Average:10.748; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000524606 NA 5.12E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 1.12E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 3.31E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 1.37E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 1.32E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 2.83E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 3.38E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 6.53E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 9.06E-06 2.49E-10 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 7.65E-11 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 2.58E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 1.68E-07 2.24E-12 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 1.08E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000524606 NA 2.61E-08 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251