\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000501145:

Variant ID: vg1000501145 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 501145
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGTGGATAGATGTAGTTAAGATGTGTTCTAGAGATAGTGTCAACCTTGTGTTTGTGAGGGTTGATATTAAGGATTTCTGCAATACTCTTTTCTTCT[G/A]
GTACATCCTGGTTGTATCCTGTAGCAGGCTCATCAACCCACTTGATTGGTTGAAAGTTTGTGCTAAAGCTACATAGAAGAATTGTATCTTAGATTAATGG

Reverse complement sequence

CCATTAATCTAAGATACAATTCTTCTATGTAGCTTTAGCACAAACTTTCAACCAATCAAGTGGGTTGATGAGCCTGCTACAGGATACAACCAGGATGTAC[C/T]
AGAAGAAAAGAGTATTGCAGAAATCCTTAATATCAACCCTCACAAACACAAGGTTGACACTATCTCTAGAACACATCTTAACTACATCTATCCACTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.50% 1.00% 39.76% 26.75% NA
All Indica  2759 15.20% 1.80% 50.82% 32.19% NA
All Japonica  1512 68.10% 0.00% 21.49% 10.45% NA
Aus  269 11.20% 0.00% 30.48% 58.36% NA
Indica I  595 18.50% 4.00% 58.15% 19.33% NA
Indica II  465 17.20% 1.70% 44.09% 36.99% NA
Indica III  913 9.60% 0.80% 50.49% 39.10% NA
Indica Intermediate  786 18.10% 1.30% 49.62% 31.04% NA
Temperate Japonica  767 88.90% 0.00% 7.69% 3.39% NA
Tropical Japonica  504 42.90% 0.00% 36.51% 20.63% NA
Japonica Intermediate  241 54.40% 0.00% 34.02% 11.62% NA
VI/Aromatic  96 16.70% 0.00% 40.62% 42.71% NA
Intermediate  90 43.30% 0.00% 34.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000501145 G -> A LOC_Os10g01770.1 N stop_gained Average:11.878; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 N N N N
vg1000501145 G -> DEL LOC_Os10g01770.1 N frameshift_variant Average:11.878; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000501145 2.41E-07 6.45E-07 mr1245_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000501145 3.79E-06 8.96E-06 mr1245_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000501145 4.27E-06 9.75E-06 mr1373_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000501145 5.48E-06 5.48E-06 mr1822_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000501145 4.43E-06 NA mr1977_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000501145 2.76E-06 3.44E-06 mr1977_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251