\
| Variant ID: vg1000501145 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 501145 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAAGTGGATAGATGTAGTTAAGATGTGTTCTAGAGATAGTGTCAACCTTGTGTTTGTGAGGGTTGATATTAAGGATTTCTGCAATACTCTTTTCTTCT[G/A]
GTACATCCTGGTTGTATCCTGTAGCAGGCTCATCAACCCACTTGATTGGTTGAAAGTTTGTGCTAAAGCTACATAGAAGAATTGTATCTTAGATTAATGG
CCATTAATCTAAGATACAATTCTTCTATGTAGCTTTAGCACAAACTTTCAACCAATCAAGTGGGTTGATGAGCCTGCTACAGGATACAACCAGGATGTAC[C/T]
AGAAGAAAAGAGTATTGCAGAAATCCTTAATATCAACCCTCACAAACACAAGGTTGACACTATCTCTAGAACACATCTTAACTACATCTATCCACTTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.50% | 1.00% | 39.76% | 26.75% | NA |
| All Indica | 2759 | 15.20% | 1.80% | 50.82% | 32.19% | NA |
| All Japonica | 1512 | 68.10% | 0.00% | 21.49% | 10.45% | NA |
| Aus | 269 | 11.20% | 0.00% | 30.48% | 58.36% | NA |
| Indica I | 595 | 18.50% | 4.00% | 58.15% | 19.33% | NA |
| Indica II | 465 | 17.20% | 1.70% | 44.09% | 36.99% | NA |
| Indica III | 913 | 9.60% | 0.80% | 50.49% | 39.10% | NA |
| Indica Intermediate | 786 | 18.10% | 1.30% | 49.62% | 31.04% | NA |
| Temperate Japonica | 767 | 88.90% | 0.00% | 7.69% | 3.39% | NA |
| Tropical Japonica | 504 | 42.90% | 0.00% | 36.51% | 20.63% | NA |
| Japonica Intermediate | 241 | 54.40% | 0.00% | 34.02% | 11.62% | NA |
| VI/Aromatic | 96 | 16.70% | 0.00% | 40.62% | 42.71% | NA |
| Intermediate | 90 | 43.30% | 0.00% | 34.44% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000501145 | G -> A | LOC_Os10g01770.1 | N | stop_gained | Average:11.878; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 | N | N | N | N |
| vg1000501145 | G -> DEL | LOC_Os10g01770.1 | N | frameshift_variant | Average:11.878; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000501145 | 2.41E-07 | 6.45E-07 | mr1245_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000501145 | 3.79E-06 | 8.96E-06 | mr1245_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000501145 | 4.27E-06 | 9.75E-06 | mr1373_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000501145 | 5.48E-06 | 5.48E-06 | mr1822_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000501145 | 4.43E-06 | NA | mr1977_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000501145 | 2.76E-06 | 3.44E-06 | mr1977_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |