\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000458156:

Variant ID: vg1000458156 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 458156
Reference Allele: ATGAlternative Allele: CTG,A
Primary Allele: CTGSecondary Allele: ATG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCATTCATCTCACTGCATATGGACCCATGGCCATTTTTAAAAGTTGAAAATTCCTAACTTGCAGGCTTTTTACCTTGGAGCTGACGACAAAATAGTCGC[ATG/CTG,A]
TTCCTATCACTTCTCTTCTTCTCTGTCCTCCAGCTCATTAGTTTTGATGGGATGGCTCATTAGAGCAAGGATAATGGTATAACTCACTTCCTACTATTAG

Reverse complement sequence

CTAATAGTAGGAAGTGAGTTATACCATTATCCTTGCTCTAATGAGCCATCCCATCAAAACTAATGAGCTGGAGGACAGAGAAGAAGAGAAGTGATAGGAA[CAT/CAG,T]
GCGACTATTTTGTCGTCAGCTCCAAGGTAAAAAGCCTGCAAGTTAGGAATTTTCAACTTTTAAAAATGGCCATGGGTCCATATGCAGTGAGATGAATGCC

Allele Frequencies:

Populations Population SizeFrequency of CTG(primary allele) Frequency of ATG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 17.00% 0.13% 0.00% A: 7.00%
All Indica  2759 96.10% 0.30% 0.00% 0.00% A: 3.59%
All Japonica  1512 49.10% 50.10% 0.26% 0.00% A: 0.53%
Aus  269 32.30% 3.00% 0.74% 0.00% A: 63.94%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.40% 0.00% 0.00% A: 0.65%
Indica III  913 93.90% 0.10% 0.00% 0.00% A: 6.02%
Indica Intermediate  786 94.30% 0.50% 0.00% 0.00% A: 5.22%
Temperate Japonica  767 19.60% 79.80% 0.52% 0.00% A: 0.13%
Tropical Japonica  504 93.10% 6.90% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 46.10% 0.00% 0.00% A: 2.90%
VI/Aromatic  96 46.90% 9.40% 0.00% 0.00% A: 43.75%
Intermediate  90 67.80% 21.10% 0.00% 0.00% A: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000458156 ATG -> CTG LOC_Os10g01700.1 upstream_gene_variant ; 574.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1000458156 ATG -> CTG LOC_Os10g01710.1 upstream_gene_variant ; 3112.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1000458156 ATG -> CTG LOC_Os10g01690.1 downstream_gene_variant ; 865.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1000458156 ATG -> CTG LOC_Os10g01690-LOC_Os10g01700 intergenic_region ; MODIFIER silent_mutation Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1000458156 ATG -> A LOC_Os10g01700.1 upstream_gene_variant ; 573.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1000458156 ATG -> A LOC_Os10g01710.1 upstream_gene_variant ; 3111.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1000458156 ATG -> A LOC_Os10g01690.1 downstream_gene_variant ; 866.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1000458156 ATG -> A LOC_Os10g01690-LOC_Os10g01700 intergenic_region ; MODIFIER silent_mutation Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000458156 2.41E-28 3.69E-50 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 8.22E-12 1.36E-16 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 4.16E-32 4.83E-73 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 1.53E-12 9.11E-20 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 3.14E-07 6.92E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 2.65E-42 8.79E-90 mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 2.95E-14 1.89E-23 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 1.40E-16 3.17E-22 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 3.24E-09 1.57E-11 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 6.89E-49 4.75E-84 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 1.17E-21 8.88E-34 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 3.26E-23 4.54E-34 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156 3.13E-12 1.81E-19 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251