Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000458156:

Variant ID: vg1000458156 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 458156
Reference Allele: ATG	Alternative Allele: CTG,A
Primary Allele: CTG	Secondary Allele: ATG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCATTCATCTCACTGCATATGGACCCATGGCCATTTTTAAAAGTTGAAAATTCCTAACTTGCAGGCTTTTTACCTTGGAGCTGACGACAAAATAGTCGC[ATG/CTG,A]
TTCCTATCACTTCTCTTCTTCTCTGTCCTCCAGCTCATTAGTTTTGATGGGATGGCTCATTAGAGCAAGGATAATGGTATAACTCACTTCCTACTATTAG

Reverse complement sequence

CTAATAGTAGGAAGTGAGTTATACCATTATCCTTGCTCTAATGAGCCATCCCATCAAAACTAATGAGCTGGAGGACAGAGAAGAAGAGAAGTGATAGGAA[CAT/CAG,T]
GCGACTATTTTGTCGTCAGCTCCAAGGTAAAAAGCCTGCAAGTTAGGAATTTTCAACTTTTAAAAATGGCCATGGGTCCATATGCAGTGAGATGAATGCC

Allele Frequencies:

Populations	Population Size	Frequency of CTG(primary allele)	Frequency of ATG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	17.00%	0.13%	0.00%	A: 7.00%
All Indica	2759	96.10%	0.30%	0.00%	0.00%	A: 3.59%
All Japonica	1512	49.10%	50.10%	0.26%	0.00%	A: 0.53%
Aus	269	32.30%	3.00%	0.74%	0.00%	A: 63.94%
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	0.40%	0.00%	0.00%	A: 0.65%
Indica III	913	93.90%	0.10%	0.00%	0.00%	A: 6.02%
Indica Intermediate	786	94.30%	0.50%	0.00%	0.00%	A: 5.22%
Temperate Japonica	767	19.60%	79.80%	0.52%	0.00%	A: 0.13%
Tropical Japonica	504	93.10%	6.90%	0.00%	0.00%	NA
Japonica Intermediate	241	51.00%	46.10%	0.00%	0.00%	A: 2.90%
VI/Aromatic	96	46.90%	9.40%	0.00%	0.00%	A: 43.75%
Intermediate	90	67.80%	21.10%	0.00%	0.00%	A: 11.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000458156	ATG -> CTG	LOC_Os10g01700.1	upstream_gene_variant ; 574.0bp to feature; MODIFIER	silent_mutation	Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg1000458156	ATG -> CTG	LOC_Os10g01710.1	upstream_gene_variant ; 3112.0bp to feature; MODIFIER	silent_mutation	Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg1000458156	ATG -> CTG	LOC_Os10g01690.1	downstream_gene_variant ; 865.0bp to feature; MODIFIER	silent_mutation	Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg1000458156	ATG -> CTG	LOC_Os10g01690-LOC_Os10g01700	intergenic_region ; MODIFIER	silent_mutation	Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg1000458156	ATG -> A	LOC_Os10g01700.1	upstream_gene_variant ; 573.0bp to feature; MODIFIER	silent_mutation	Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg1000458156	ATG -> A	LOC_Os10g01710.1	upstream_gene_variant ; 3111.0bp to feature; MODIFIER	silent_mutation	Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg1000458156	ATG -> A	LOC_Os10g01690.1	downstream_gene_variant ; 866.0bp to feature; MODIFIER	silent_mutation	Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg1000458156	ATG -> A	LOC_Os10g01690-LOC_Os10g01700	intergenic_region ; MODIFIER	silent_mutation	Average:61.757; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000458156	2.41E-28	3.69E-50	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	8.22E-12	1.36E-16	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	4.16E-32	4.83E-73	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	1.53E-12	9.11E-20	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	3.14E-07	6.92E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	2.65E-42	8.79E-90	mr1926	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	2.95E-14	1.89E-23	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	1.40E-16	3.17E-22	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	3.24E-09	1.57E-11	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	6.89E-49	4.75E-84	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	1.17E-21	8.88E-34	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	3.26E-23	4.54E-34	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000458156	3.13E-12	1.81E-19	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251