Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000443925:

Variant ID: vg1000443925 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 443925
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTATCAACCAAAACATGTTTAGAATGGAGCCAAAGAATATTTCAACAATATTATCCTAACATAAACATTTGCAATAAAAATTAAAACAACATTAAACA[T/A]
GGTGCCCGCGCATTTTGCGCAGGCTACCTTCCTAGTTTAAGTAATTATTAATTATTTTCCTATCATTTGATTCATTGTTAAATATATTTCTATGTAGGCA

Reverse complement sequence

TGCCTACATAGAAATATATTTAACAATGAATCAAATGATAGGAAAATAATTAATAATTACTTAAACTAGGAAGGTAGCCTGCGCAAAATGCGCGGGCACC[A/T]
TGTTTAATGTTGTTTTAATTTTTATTGCAAATGTTTATGTTAGGATAATATTGTTGAAATATTCTTTGGCTCCATTCTAAACATGTTTTGGTTGATAATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.30%	17.00%	0.32%	4.34%	NA
All Indica	2759	97.90%	0.40%	0.14%	1.49%	NA
All Japonica	1512	49.30%	50.30%	0.00%	0.33%	NA
Aus	269	42.40%	3.00%	4.09%	50.56%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.00%	0.22%	NA
Indica III	913	97.90%	0.40%	0.22%	1.42%	NA
Indica Intermediate	786	95.70%	0.60%	0.25%	3.44%	NA
Temperate Japonica	767	20.10%	79.70%	0.00%	0.26%	NA
Tropical Japonica	504	92.30%	7.70%	0.00%	0.00%	NA
Japonica Intermediate	241	52.70%	46.10%	0.00%	1.24%	NA
VI/Aromatic	96	70.80%	9.40%	0.00%	19.79%	NA
Intermediate	90	78.90%	16.70%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000443925	T -> A	LOC_Os10g01680.1	upstream_gene_variant ; 4745.0bp to feature; MODIFIER	silent_mutation	Average:32.116; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1000443925	T -> A	LOC_Os10g01670.1	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:32.116; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1000443925	T -> A	LOC_Os10g01660-LOC_Os10g01670	intergenic_region ; MODIFIER	silent_mutation	Average:32.116; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1000443925	T -> DEL	N	N	silent_mutation	Average:32.116; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000443925	4.14E-06	4.14E-06	mr1260	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	2.97E-27	5.49E-49	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	2.49E-11	5.51E-16	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	2.17E-30	1.02E-70	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	2.23E-11	2.24E-18	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	1.76E-07	5.39E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	3.45E-41	5.39E-88	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	1.38E-13	2.15E-22	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	8.75E-17	2.16E-22	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	1.90E-09	9.88E-12	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	4.44E-48	3.23E-83	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	1.01E-20	9.02E-33	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	5.71E-25	2.02E-35	mr1959_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925	3.10E-13	1.27E-20	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251