\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000443925:

Variant ID: vg1000443925 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 443925
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTATCAACCAAAACATGTTTAGAATGGAGCCAAAGAATATTTCAACAATATTATCCTAACATAAACATTTGCAATAAAAATTAAAACAACATTAAACA[T/A]
GGTGCCCGCGCATTTTGCGCAGGCTACCTTCCTAGTTTAAGTAATTATTAATTATTTTCCTATCATTTGATTCATTGTTAAATATATTTCTATGTAGGCA

Reverse complement sequence

TGCCTACATAGAAATATATTTAACAATGAATCAAATGATAGGAAAATAATTAATAATTACTTAAACTAGGAAGGTAGCCTGCGCAAAATGCGCGGGCACC[A/T]
TGTTTAATGTTGTTTTAATTTTTATTGCAAATGTTTATGTTAGGATAATATTGTTGAAATATTCTTTGGCTCCATTCTAAACATGTTTTGGTTGATAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 17.00% 0.32% 4.34% NA
All Indica  2759 97.90% 0.40% 0.14% 1.49% NA
All Japonica  1512 49.30% 50.30% 0.00% 0.33% NA
Aus  269 42.40% 3.00% 4.09% 50.56% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.00% 0.22% NA
Indica III  913 97.90% 0.40% 0.22% 1.42% NA
Indica Intermediate  786 95.70% 0.60% 0.25% 3.44% NA
Temperate Japonica  767 20.10% 79.70% 0.00% 0.26% NA
Tropical Japonica  504 92.30% 7.70% 0.00% 0.00% NA
Japonica Intermediate  241 52.70% 46.10% 0.00% 1.24% NA
VI/Aromatic  96 70.80% 9.40% 0.00% 19.79% NA
Intermediate  90 78.90% 16.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000443925 T -> A LOC_Os10g01680.1 upstream_gene_variant ; 4745.0bp to feature; MODIFIER silent_mutation Average:32.116; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1000443925 T -> A LOC_Os10g01670.1 downstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:32.116; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1000443925 T -> A LOC_Os10g01660-LOC_Os10g01670 intergenic_region ; MODIFIER silent_mutation Average:32.116; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1000443925 T -> DEL N N silent_mutation Average:32.116; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000443925 4.14E-06 4.14E-06 mr1260 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 2.97E-27 5.49E-49 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 2.49E-11 5.51E-16 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 2.17E-30 1.02E-70 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 2.23E-11 2.24E-18 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 1.76E-07 5.39E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 3.45E-41 5.39E-88 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 1.38E-13 2.15E-22 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 8.75E-17 2.16E-22 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 1.90E-09 9.88E-12 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 4.44E-48 3.23E-83 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 1.01E-20 9.02E-33 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 5.71E-25 2.02E-35 mr1959_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443925 3.10E-13 1.27E-20 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251