Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000401399:

Variant ID: vg1000401399 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 401399
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATATAACTTGCCATGCCGTATTATCTTTGAACTCAGTCTCTTCTAGATAAGCTTCCTTTAGTAGATCAATTTCCTTAACCGAATATAGCAAGAATCCGA[C/T]
AACTGACGACTTGACAACTCTCATCGGCTAATCTCAGAACTTCGAAGACGATGTTGACTCTAAGCCGATGACTACTCCAGGCTTACCAAATTTCACTGTT

Reverse complement sequence

AACAGTGAAATTTGGTAAGCCTGGAGTAGTCATCGGCTTAGAGTCAACATCGTCTTCGAAGTTCTGAGATTAGCCGATGAGAGTTGTCAAGTCGTCAGTT[G/A]
TCGGATTCTTGCTATATTCGGTTAAGGAAATTGATCTACTAAAGGAAGCTTATCTAGAAGAGACTGAGTTCAAAGATAATACGGCATGGCAAGTTATATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	2.50%	0.61%	19.15%	NA
All Indica	2759	72.30%	0.00%	0.65%	27.00%	NA
All Japonica	1512	91.10%	6.90%	0.07%	1.98%	NA
Aus	269	66.50%	0.00%	2.23%	31.23%	NA
Indica I	595	81.20%	0.00%	0.50%	18.32%	NA
Indica II	465	52.90%	0.20%	0.86%	46.02%	NA
Indica III	913	78.90%	0.00%	0.44%	20.70%	NA
Indica Intermediate	786	69.50%	0.00%	0.89%	29.64%	NA
Temperate Japonica	767	86.70%	12.80%	0.13%	0.39%	NA
Tropical Japonica	504	97.60%	0.60%	0.00%	1.79%	NA
Japonica Intermediate	241	91.30%	1.20%	0.00%	7.47%	NA
VI/Aromatic	96	50.00%	13.50%	2.08%	34.38%	NA
Intermediate	90	82.20%	1.10%	2.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000401399	C -> T	LOC_Os10g01600.1	upstream_gene_variant ; 2697.0bp to feature; MODIFIER	silent_mutation	Average:14.619; most accessible tissue: Minghui63 young leaf, score: 27.355	N	N	N	N
vg1000401399	C -> T	LOC_Os10g01600-LOC_Os10g01610	intergenic_region ; MODIFIER	silent_mutation	Average:14.619; most accessible tissue: Minghui63 young leaf, score: 27.355	N	N	N	N
vg1000401399	C -> DEL	N	N	silent_mutation	Average:14.619; most accessible tissue: Minghui63 young leaf, score: 27.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000401399	NA	1.36E-17	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000401399	4.84E-07	3.40E-10	mr1343	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	2.38E-06	2.38E-06	mr1343	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	9.02E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	2.80E-10	1.74E-17	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	1.71E-07	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	9.13E-09	3.01E-18	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	2.39E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	2.57E-06	mr1038_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	4.83E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	6.69E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	8.64E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	5.33E-08	1.63E-18	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	8.80E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	NA	1.19E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000401399	6.82E-06	2.55E-19	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251