Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000264080:

Variant ID: vg1000264080 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 264080
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGCTAGGCAAACGACTGGAACCGGCAACAAGGTGACCGTGACGATGCCTCCACGCAAACGACGCCGACGTGCGTGCGTGACCGTGACGCCGCCGCCGG[C/T]
GGAGCCCACGCCGGAGTTGTTTCTGCCGCCGAAACTCCTGCTGGAGATCGTCGCTCGGTCGGACGGCGGCACACTCGTCCGGTGCGCCGTGGCATCCAAT

Reverse complement sequence

ATTGGATGCCACGGCGCACCGGACGAGTGTGCCGCCGTCCGACCGAGCGACGATCTCCAGCAGGAGTTTCGGCGGCAGAAACAACTCCGGCGTGGGCTCC[G/A]
CCGGCGGCGGCGTCACGGTCACGCACGCACGTCGGCGTCGTTTGCGTGGAGGCATCGTCACGGTCACCTTGTTGCCGGTTCCAGTCGTTTGCCTAGCTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	6.80%	0.32%	16.53%	NA
All Indica	2759	98.60%	0.10%	0.00%	1.30%	NA
All Japonica	1512	43.50%	19.70%	0.60%	36.18%	NA
Aus	269	48.70%	3.00%	2.23%	46.10%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.60%	0.20%	0.00%	2.15%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	96.70%	0.10%	0.00%	3.18%	NA
Temperate Japonica	767	66.50%	22.70%	0.26%	10.56%	NA
Tropical Japonica	504	19.20%	6.50%	0.79%	73.41%	NA
Japonica Intermediate	241	21.20%	37.80%	1.24%	39.83%	NA
VI/Aromatic	96	32.30%	10.40%	0.00%	57.29%	NA
Intermediate	90	75.60%	3.30%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000264080	C -> T	LOC_Os10g01440.1	upstream_gene_variant ; 1000.0bp to feature; MODIFIER	silent_mutation	Average:13.661; most accessible tissue: Callus, score: 36.258	N	N	N	N
vg1000264080	C -> T	LOC_Os10g01450.1	upstream_gene_variant ; 4617.0bp to feature; MODIFIER	silent_mutation	Average:13.661; most accessible tissue: Callus, score: 36.258	N	N	N	N
vg1000264080	C -> T	LOC_Os10g01430.1	downstream_gene_variant ; 3598.0bp to feature; MODIFIER	silent_mutation	Average:13.661; most accessible tissue: Callus, score: 36.258	N	N	N	N
vg1000264080	C -> T	LOC_Os10g01430-LOC_Os10g01440	intergenic_region ; MODIFIER	silent_mutation	Average:13.661; most accessible tissue: Callus, score: 36.258	N	N	N	N
vg1000264080	C -> DEL	N	N	silent_mutation	Average:13.661; most accessible tissue: Callus, score: 36.258	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000264080	NA	3.12E-21	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000264080	NA	6.24E-08	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000264080	NA	2.25E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000264080	NA	2.26E-10	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000264080	7.77E-07	6.57E-22	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000264080	NA	5.19E-08	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251