\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000264080:

Variant ID: vg1000264080 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 264080
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGCTAGGCAAACGACTGGAACCGGCAACAAGGTGACCGTGACGATGCCTCCACGCAAACGACGCCGACGTGCGTGCGTGACCGTGACGCCGCCGCCGG[C/T]
GGAGCCCACGCCGGAGTTGTTTCTGCCGCCGAAACTCCTGCTGGAGATCGTCGCTCGGTCGGACGGCGGCACACTCGTCCGGTGCGCCGTGGCATCCAAT

Reverse complement sequence

ATTGGATGCCACGGCGCACCGGACGAGTGTGCCGCCGTCCGACCGAGCGACGATCTCCAGCAGGAGTTTCGGCGGCAGAAACAACTCCGGCGTGGGCTCC[G/A]
CCGGCGGCGGCGTCACGGTCACGCACGCACGTCGGCGTCGTTTGCGTGGAGGCATCGTCACGGTCACCTTGTTGCCGGTTCCAGTCGTTTGCCTAGCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 6.80% 0.32% 16.53% NA
All Indica  2759 98.60% 0.10% 0.00% 1.30% NA
All Japonica  1512 43.50% 19.70% 0.60% 36.18% NA
Aus  269 48.70% 3.00% 2.23% 46.10% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 0.20% 0.00% 2.15% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 96.70% 0.10% 0.00% 3.18% NA
Temperate Japonica  767 66.50% 22.70% 0.26% 10.56% NA
Tropical Japonica  504 19.20% 6.50% 0.79% 73.41% NA
Japonica Intermediate  241 21.20% 37.80% 1.24% 39.83% NA
VI/Aromatic  96 32.30% 10.40% 0.00% 57.29% NA
Intermediate  90 75.60% 3.30% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000264080 C -> T LOC_Os10g01440.1 upstream_gene_variant ; 1000.0bp to feature; MODIFIER silent_mutation Average:13.661; most accessible tissue: Callus, score: 36.258 N N N N
vg1000264080 C -> T LOC_Os10g01450.1 upstream_gene_variant ; 4617.0bp to feature; MODIFIER silent_mutation Average:13.661; most accessible tissue: Callus, score: 36.258 N N N N
vg1000264080 C -> T LOC_Os10g01430.1 downstream_gene_variant ; 3598.0bp to feature; MODIFIER silent_mutation Average:13.661; most accessible tissue: Callus, score: 36.258 N N N N
vg1000264080 C -> T LOC_Os10g01430-LOC_Os10g01440 intergenic_region ; MODIFIER silent_mutation Average:13.661; most accessible tissue: Callus, score: 36.258 N N N N
vg1000264080 C -> DEL N N silent_mutation Average:13.661; most accessible tissue: Callus, score: 36.258 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000264080 NA 3.12E-21 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000264080 NA 6.24E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000264080 NA 2.25E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000264080 NA 2.26E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000264080 7.77E-07 6.57E-22 mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000264080 NA 5.19E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251