\
| Variant ID: vg1000264080 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 264080 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGAGCTAGGCAAACGACTGGAACCGGCAACAAGGTGACCGTGACGATGCCTCCACGCAAACGACGCCGACGTGCGTGCGTGACCGTGACGCCGCCGCCGG[C/T]
GGAGCCCACGCCGGAGTTGTTTCTGCCGCCGAAACTCCTGCTGGAGATCGTCGCTCGGTCGGACGGCGGCACACTCGTCCGGTGCGCCGTGGCATCCAAT
ATTGGATGCCACGGCGCACCGGACGAGTGTGCCGCCGTCCGACCGAGCGACGATCTCCAGCAGGAGTTTCGGCGGCAGAAACAACTCCGGCGTGGGCTCC[G/A]
CCGGCGGCGGCGTCACGGTCACGCACGCACGTCGGCGTCGTTTGCGTGGAGGCATCGTCACGGTCACCTTGTTGCCGGTTCCAGTCGTTTGCCTAGCTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.30% | 6.80% | 0.32% | 16.53% | NA |
| All Indica | 2759 | 98.60% | 0.10% | 0.00% | 1.30% | NA |
| All Japonica | 1512 | 43.50% | 19.70% | 0.60% | 36.18% | NA |
| Aus | 269 | 48.70% | 3.00% | 2.23% | 46.10% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 0.20% | 0.00% | 2.15% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 96.70% | 0.10% | 0.00% | 3.18% | NA |
| Temperate Japonica | 767 | 66.50% | 22.70% | 0.26% | 10.56% | NA |
| Tropical Japonica | 504 | 19.20% | 6.50% | 0.79% | 73.41% | NA |
| Japonica Intermediate | 241 | 21.20% | 37.80% | 1.24% | 39.83% | NA |
| VI/Aromatic | 96 | 32.30% | 10.40% | 0.00% | 57.29% | NA |
| Intermediate | 90 | 75.60% | 3.30% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000264080 | C -> T | LOC_Os10g01440.1 | upstream_gene_variant ; 1000.0bp to feature; MODIFIER | silent_mutation | Average:13.661; most accessible tissue: Callus, score: 36.258 | N | N | N | N |
| vg1000264080 | C -> T | LOC_Os10g01450.1 | upstream_gene_variant ; 4617.0bp to feature; MODIFIER | silent_mutation | Average:13.661; most accessible tissue: Callus, score: 36.258 | N | N | N | N |
| vg1000264080 | C -> T | LOC_Os10g01430.1 | downstream_gene_variant ; 3598.0bp to feature; MODIFIER | silent_mutation | Average:13.661; most accessible tissue: Callus, score: 36.258 | N | N | N | N |
| vg1000264080 | C -> T | LOC_Os10g01430-LOC_Os10g01440 | intergenic_region ; MODIFIER | silent_mutation | Average:13.661; most accessible tissue: Callus, score: 36.258 | N | N | N | N |
| vg1000264080 | C -> DEL | N | N | silent_mutation | Average:13.661; most accessible tissue: Callus, score: 36.258 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000264080 | NA | 3.12E-21 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1000264080 | NA | 6.24E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1000264080 | NA | 2.25E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000264080 | NA | 2.26E-10 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000264080 | 7.77E-07 | 6.57E-22 | mr1679_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000264080 | NA | 5.19E-08 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |