\
| Variant ID: vg1000205246 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 205246 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.27, others allele: 0.00, population size: 86. )
CCACAGTTTCTTTGCCTTTATTTCTTGTTGATTACAGGATCAAATCAACTGGCACGCTAGTACACCCGAATGCGAGCTTTGGACCTGCACTGGAGTTAAG[T/C]
AGATCTCCTAGGCCTCGTGTTTTCTGTCAACACCATGCGACCTAGGACAGGCTGGGGTTCAGTACCTCCTGCTTCTCTTTCCATGGTCCCACGACCGGGA
TCCCGGTCGTGGGACCATGGAAAGAGAAGCAGGAGGTACTGAACCCCAGCCTGTCCTAGGTCGCATGGTGTTGACAGAAAACACGAGGCCTAGGAGATCT[A/G]
CTTAACTCCAGTGCAGGTCCAAAGCTCGCATTCGGGTGTACTAGCGTGCCAGTTGATTTGATCCTGTAATCAACAAGAAATAAAGGCAAAGAAACTGTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.70% | 17.80% | 0.59% | 61.85% | NA |
| All Indica | 2759 | 2.50% | 28.50% | 0.76% | 68.21% | NA |
| All Japonica | 1512 | 54.20% | 1.60% | 0.20% | 43.98% | NA |
| Aus | 269 | 4.80% | 4.80% | 0.37% | 89.96% | NA |
| Indica I | 595 | 2.20% | 18.50% | 1.01% | 78.32% | NA |
| Indica II | 465 | 3.40% | 46.00% | 0.65% | 49.89% | NA |
| Indica III | 913 | 2.30% | 23.20% | 0.55% | 73.93% | NA |
| Indica Intermediate | 786 | 2.40% | 31.90% | 0.89% | 64.76% | NA |
| Temperate Japonica | 767 | 85.50% | 1.00% | 0.26% | 13.17% | NA |
| Tropical Japonica | 504 | 8.70% | 2.20% | 0.20% | 88.89% | NA |
| Japonica Intermediate | 241 | 49.80% | 2.10% | 0.00% | 48.13% | NA |
| VI/Aromatic | 96 | 10.40% | 1.00% | 0.00% | 88.54% | NA |
| Intermediate | 90 | 23.30% | 18.90% | 3.33% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000205246 | T -> C | LOC_Os10g01330.1 | upstream_gene_variant ; 2222.0bp to feature; MODIFIER | silent_mutation | Average:23.776; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| vg1000205246 | T -> C | LOC_Os10g01340.1 | downstream_gene_variant ; 3627.0bp to feature; MODIFIER | silent_mutation | Average:23.776; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| vg1000205246 | T -> C | LOC_Os10g01330-LOC_Os10g01340 | intergenic_region ; MODIFIER | silent_mutation | Average:23.776; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| vg1000205246 | T -> DEL | N | N | silent_mutation | Average:23.776; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000205246 | NA | 1.10E-21 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | NA | 5.28E-45 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | 2.79E-08 | 5.17E-40 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | 1.17E-07 | NA | mr1113_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | 1.15E-06 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | 2.06E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | 4.59E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | 1.45E-07 | NA | mr1120_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | 7.15E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | 1.58E-09 | NA | mr1247_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | NA | 3.91E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | NA | 4.20E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | NA | 4.85E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000205246 | NA | 1.95E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |