\
| Variant ID: vg0922613922 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 22613922 |
| Reference Allele: C | Alternative Allele: CCTCTCTCT,CTCT,CCT,CTCTCTCTCTCT,CCTCTCT,CTCTCTCT |
| Primary Allele: C | Secondary Allele: CCTCTCTCT |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.23, others allele: 0.00, population size: 95. )
CCAAAGTACTGGCCCAATTACGGTGACCTGCTAAGTTTTATCCGTAATCTGATTGAACATTTGGATGAACACAAACACGTATGCTCTCTCTCTCTCCCTC[C/CCTCTCTCT,CTCT,CCT,CTCTCTCTCTCT,CCTCTCT,CTCTCTCT]
CTCTCTCTCTCTCTCTCTCTATTTGACAGTTGACACTGTTGTGTTTCGACATCTGTAGGAGGAGAATATTACTGATATTGTTGACGCTGAGCTCTTTGCA
TGCAAAGAGCTCAGCGTCAACAATATCAGTAATATTCTCCTCCTACAGATGTCGAAACACAACAGTGTCAACTGTCAAATAGAGAGAGAGAGAGAGAGAG[G/AGAGAGAGG,AGAG,AGG,AGAGAGAGAGAG,AGAGAGG,AGAGAGAG]
GAGGGAGAGAGAGAGAGCATACGTGTTTGTGTTCATCCAAATGTTCAATCAGATTACGGATAAAACTTAGCAGGTCACCGTAATTGGGCCAGTACTTTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of CCTCTCTCT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.80% | 24.20% | 6.67% | 0.00% | CTCT: 18.54%; CCT: 5.40%; CTCTCTCTCTCT: 3.62%; CCTCTCT: 2.43%; CTCTCTCT: 2.41% |
| All Indica | 2759 | 4.10% | 39.90% | 9.13% | 0.00% | CTCT: 31.28%; CTCTCTCTCTCT: 6.13%; CTCTCTCT: 4.02%; CCTCTCT: 3.81%; CCT: 1.63% |
| All Japonica | 1512 | 98.50% | 0.00% | 0.33% | 0.00% | CCT: 0.73%; CTCT: 0.26%; CTCTCTCT: 0.13% |
| Aus | 269 | 8.60% | 11.90% | 8.55% | 0.00% | CCT: 67.66%; CCTCTCT: 2.60%; CTCT: 0.74% |
| Indica I | 595 | 3.40% | 18.20% | 14.96% | 0.00% | CTCT: 62.02%; CCTCTCT: 1.18%; CTCTCTCTCTCT: 0.34% |
| Indica II | 465 | 4.10% | 33.80% | 6.24% | 0.00% | CTCT: 39.57%; CTCTCTCTCTCT: 9.68%; CTCTCTCT: 4.95%; CCTCTCT: 1.29%; CCT: 0.43% |
| Indica III | 913 | 3.00% | 59.80% | 5.70% | 0.00% | CTCTCTCTCTCT: 8.87%; CTCT: 8.00%; CCTCTCT: 6.68%; CTCTCTCT: 6.68%; CCT: 1.31% |
| Indica Intermediate | 786 | 6.00% | 36.90% | 10.43% | 0.00% | CTCT: 30.15%; CTCTCTCTCTCT: 5.22%; CCTCTCT: 3.94%; CCT: 3.94%; CTCTCTCT: 3.44% |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.39% | 0.00% | CCT: 0.26%; CTCT: 0.13%; CTCTCTCT: 0.13% |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.20% | 0.00% | CCT: 1.79%; CTCT: 0.20%; CTCTCTCT: 0.20% |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.00% | CTCT: 0.83% |
| VI/Aromatic | 96 | 63.50% | 2.10% | 25.00% | 0.00% | CCT: 7.29%; CCTCTCT: 2.08% |
| Intermediate | 90 | 55.60% | 8.90% | 12.22% | 0.00% | CCT: 11.11%; CTCT: 7.78%; CTCTCTCTCTCT: 2.22%; CCTCTCT: 1.11%; CTCTCTCT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922613922 | C -> CTCTCTCT | LOC_Os09g39330.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922613922 | C -> CCTCTCT | LOC_Os09g39330.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922613922 | C -> CCTCTCTCT | LOC_Os09g39330.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922613922 | C -> CCT | LOC_Os09g39330.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922613922 | C -> CTCTCTCTCTCT | LOC_Os09g39330.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922613922 | C -> CTCT | LOC_Os09g39330.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922613922 | 5.81E-07 | 1.82E-07 | mr1185 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | 1.67E-06 | 1.41E-06 | mr1185 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | NA | 9.05E-07 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | NA | 2.71E-06 | mr1344 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | NA | 5.93E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | 1.07E-06 | NA | mr1458 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | NA | 1.19E-07 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | NA | 8.01E-06 | mr1625 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | 3.15E-06 | NA | mr1808 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | 5.28E-06 | 5.28E-06 | mr1808 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | 1.13E-07 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | 1.27E-08 | 1.07E-10 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922613922 | NA | 9.22E-07 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |