Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0922436614:

Variant ID: vg0922436614 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22436614
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.08, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCTCTTAATGGGATACACGCCGTACATGGATATGCCACATAGCCCTTCCTTAGCTGCTATGTCACGCTTCATGCGGATGTAGCCACTCTCTCCCCATC[T/C]
AGGACCCCACGAGTTCCTAGCAATCCAATAGTTGATGTTGTCCTGTGTCACGCCATACCCAACAGTTGTTACTGCATGGTTTACCGATGTCCCGCACGGT

Reverse complement sequence

ACCGTGCGGGACATCGGTAAACCATGCAGTAACAACTGTTGGGTATGGCGTGACACAGGACAACATCAACTATTGGATTGCTAGGAACTCGTGGGGTCCT[A/G]
GATGGGGAGAGAGTGGCTACATCCGCATGAAGCGTGACATAGCAGCTAAGGAAGGGCTATGTGGCATATCCATGTACGGCGTGTATCCCATTAAGAGAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.30%	33.20%	4.63%	21.86%	NA
All Indica	2759	3.70%	53.80%	7.61%	34.87%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	56.50%	20.80%	2.60%	20.07%	NA
Indica I	595	2.90%	46.90%	13.28%	36.97%	NA
Indica II	465	3.00%	61.70%	9.25%	26.02%	NA
Indica III	913	2.00%	57.00%	3.29%	37.79%	NA
Indica Intermediate	786	6.90%	50.60%	7.38%	35.11%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	3.10%	0.00%	3.12%	NA
Intermediate	90	60.00%	22.20%	2.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922436614	T -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436614	T -> C	LOC_Os09g39080.1	upstream_gene_variant ; 2938.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436614	T -> C	LOC_Os09g39090.1	downstream_gene_variant ; 1445.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922436614	T -> C	LOC_Os09g39080-LOC_Os09g39090	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922436614	9.04E-08	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436614	5.88E-09	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436614	3.57E-06	2.10E-08	mr1865_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922436614	NA	1.29E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251