\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922324460:

Variant ID: vg0922324460 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22324460
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCGGTTTTACCTGACGTGGCAGGTGAGTTAGCATGGGCCCCACGTGGGCCCCGCCTGTCAGTACGCCAGCTCATCTCTCTCCCCCACTTCTCTCCTTCC[A/T]
CATCTCTCTCTCGCTTCCCCCCTCTCTGCAAGGCGGCTAGCGGGTGGGGAGGAGGTCCGGTGAGGACGACACAGGAGAAGAAGGCGGCAGCGGCTGCGAC

Reverse complement sequence

GTCGCAGCCGCTGCCGCCTTCTTCTCCTGTGTCGTCCTCACCGGACCTCCTCCCCACCCGCTAGCCGCCTTGCAGAGAGGGGGGAAGCGAGAGAGAGATG[T/A]
GGAAGGAGAGAAGTGGGGGAGAGAGATGAGCTGGCGTACTGACAGGCGGGGCCCACGTGGGGCCCATGCTAACTCACCTGCCACGTCAGGTAAAACCGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 14.90% 1.90% 42.07% NA
All Indica  2759 7.30% 23.20% 3.26% 66.22% NA
All Japonica  1512 99.40% 0.00% 0.00% 0.60% NA
Aus  269 31.20% 21.90% 0.00% 46.84% NA
Indica I  595 7.40% 16.30% 1.85% 74.45% NA
Indica II  465 16.10% 3.00% 3.44% 77.42% NA
Indica III  913 2.30% 38.90% 4.16% 54.65% NA
Indica Intermediate  786 7.90% 22.10% 3.18% 66.79% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 66.70% 7.80% 0.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922324460 A -> DEL N N silent_mutation Average:21.739; most accessible tissue: Callus, score: 95.829 N N N N
vg0922324460 A -> T LOC_Os09g38870.1 upstream_gene_variant ; 729.0bp to feature; MODIFIER silent_mutation Average:21.739; most accessible tissue: Callus, score: 95.829 N N N N
vg0922324460 A -> T LOC_Os09g38880.1 downstream_gene_variant ; 4967.0bp to feature; MODIFIER silent_mutation Average:21.739; most accessible tissue: Callus, score: 95.829 N N N N
vg0922324460 A -> T LOC_Os09g38850-LOC_Os09g38870 intergenic_region ; MODIFIER silent_mutation Average:21.739; most accessible tissue: Callus, score: 95.829 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922324460 2.80E-07 NA mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922324460 NA 8.74E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922324460 NA 1.52E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922324460 NA 3.61E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922324460 NA 1.73E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251