\
| Variant ID: vg0922324460 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22324460 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCCGGTTTTACCTGACGTGGCAGGTGAGTTAGCATGGGCCCCACGTGGGCCCCGCCTGTCAGTACGCCAGCTCATCTCTCTCCCCCACTTCTCTCCTTCC[A/T]
CATCTCTCTCTCGCTTCCCCCCTCTCTGCAAGGCGGCTAGCGGGTGGGGAGGAGGTCCGGTGAGGACGACACAGGAGAAGAAGGCGGCAGCGGCTGCGAC
GTCGCAGCCGCTGCCGCCTTCTTCTCCTGTGTCGTCCTCACCGGACCTCCTCCCCACCCGCTAGCCGCCTTGCAGAGAGGGGGGAAGCGAGAGAGAGATG[T/A]
GGAAGGAGAGAAGTGGGGGAGAGAGATGAGCTGGCGTACTGACAGGCGGGGCCCACGTGGGGCCCATGCTAACTCACCTGCCACGTCAGGTAAAACCGGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.10% | 14.90% | 1.90% | 42.07% | NA |
| All Indica | 2759 | 7.30% | 23.20% | 3.26% | 66.22% | NA |
| All Japonica | 1512 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Aus | 269 | 31.20% | 21.90% | 0.00% | 46.84% | NA |
| Indica I | 595 | 7.40% | 16.30% | 1.85% | 74.45% | NA |
| Indica II | 465 | 16.10% | 3.00% | 3.44% | 77.42% | NA |
| Indica III | 913 | 2.30% | 38.90% | 4.16% | 54.65% | NA |
| Indica Intermediate | 786 | 7.90% | 22.10% | 3.18% | 66.79% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 66.70% | 7.80% | 0.00% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922324460 | A -> DEL | N | N | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 95.829 | N | N | N | N |
| vg0922324460 | A -> T | LOC_Os09g38870.1 | upstream_gene_variant ; 729.0bp to feature; MODIFIER | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 95.829 | N | N | N | N |
| vg0922324460 | A -> T | LOC_Os09g38880.1 | downstream_gene_variant ; 4967.0bp to feature; MODIFIER | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 95.829 | N | N | N | N |
| vg0922324460 | A -> T | LOC_Os09g38850-LOC_Os09g38870 | intergenic_region ; MODIFIER | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 95.829 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922324460 | 2.80E-07 | NA | mr1682 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922324460 | NA | 8.74E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922324460 | NA | 1.52E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922324460 | NA | 3.61E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922324460 | NA | 1.73E-06 | mr1836_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |