\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922309029:

Variant ID: vg0922309029 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 22309029
Reference Allele: GGTAlternative Allele: AGT,G
Primary Allele: GGTSecondary Allele: AGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAGAAGCTTTTTCTTTCCCTCTTACACTAGCATTAACCACGGGATCAATTATTGGCATTGGAGTTGGTAGTGGCGCTGGGATTTTGGTCATGGCTCTC[GGT/AGT,G]
GCAACCTTTTTAACACATAGGATTAAGAATCGGAGAGCAAGAATGCTGAGACAGAAGTTCTTCAAACAGAACCGTGGCCATTTGTTGGAACAGTTGGTAT

Reverse complement sequence

ATACCAACTGTTCCAACAAATGGCCACGGTTCTGTTTGAAGAACTTCTGTCTCAGCATTCTTGCTCTCCGATTCTTAATCCTATGTGTTAAAAAGGTTGC[ACC/ACT,C]
GAGAGCCATGACCAAAATCCCAGCGCCACTACCAACTCCAATGCCAATAATTGATCCCGTGGTTAATGCTAGTGTAAGAGGGAAAGAAAAAGCTTCTCCA

Allele Frequencies:

Populations Population SizeFrequency of GGT(primary allele) Frequency of AGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.90% 0.60% 0.04% 0.49% NA
All Indica  2759 98.30% 0.90% 0.04% 0.72% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 98.00% 0.00% 0.11% 1.86% NA
Indica Intermediate  786 99.60% 0.10% 0.00% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922309029 GGT -> G LOC_Os09g38834.1 frameshift_variant ; p.Ala389fs; HIGH N Average:49.048; most accessible tissue: Callus, score: 65.894 N N N N
vg0922309029 GGT -> G LOC_Os09g38840.1 upstream_gene_variant ; 2567.0bp to feature; MODIFIER N Average:49.048; most accessible tissue: Callus, score: 65.894 N N N N
vg0922309029 GGT -> AGT LOC_Os09g38834.1 missense_variant ; p.Gly388Ser; MODERATE N Average:49.048; most accessible tissue: Callus, score: 65.894 N N N N
vg0922309029 GGT -> AGT LOC_Os09g38840.1 upstream_gene_variant ; 2568.0bp to feature; MODIFIER N Average:49.048; most accessible tissue: Callus, score: 65.894 N N N N
vg0922309029 GGT -> AGT LOC_Os09g38830.1 downstream_gene_variant ; 3506.0bp to feature; MODIFIER N Average:49.048; most accessible tissue: Callus, score: 65.894 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922309029 NA 7.35E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029 NA 4.93E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029 NA 6.97E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029 NA 1.49E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029 NA 9.55E-07 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029 3.32E-06 9.73E-09 mr1570_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029 1.85E-06 7.82E-09 mr1571_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922309029 NA 3.51E-06 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251