Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922265212:

Variant ID: vg0922265212 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22265212
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTTTAGGATTTGGTTTACAATTTGAAACTCTAACAACACCTTGGCTAGGAAGAGACCAAATTTGTTACTATCTCCGTTCTAAAATATCAGGAATTTTG[C/T]
TCATGTTAGAACGGGGCAGTATATTTTGTCATTGAGACCGAGACGTGAAACCTTTGTGATGAAGAAGACATTTTATCACAAGTATGATAAAGAACCATAA

Reverse complement sequence

TTATGGTTCTTTATCATACTTGTGATAAAATGTCTTCTTCATCACAAAGGTTTCACGTCTCGGTCTCAATGACAAAATATACTGCCCCGTTCTAACATGA[G/A]
CAAAATTCCTGATATTTTAGAACGGAGATAGTAACAAATTTGGTCTCTTCCTAGCCAAGGTGTTGTTAGAGTTTCAAATTGTAAACCAAATCCTAAACGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	4.00%	0.06%	0.00%	NA
All Indica	2759	97.10%	2.80%	0.07%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	61.70%	37.90%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	92.00%	7.50%	0.43%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	4.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922265212	C -> T	LOC_Os09g38740.1	upstream_gene_variant ; 834.0bp to feature; MODIFIER	silent_mutation	Average:55.563; most accessible tissue: Callus, score: 78.705	N	N	N	N
vg0922265212	C -> T	LOC_Os09g38755.1	upstream_gene_variant ; 3890.0bp to feature; MODIFIER	silent_mutation	Average:55.563; most accessible tissue: Callus, score: 78.705	N	N	N	N
vg0922265212	C -> T	LOC_Os09g38730.1	downstream_gene_variant ; 3258.0bp to feature; MODIFIER	silent_mutation	Average:55.563; most accessible tissue: Callus, score: 78.705	N	N	N	N
vg0922265212	C -> T	LOC_Os09g38750.1	downstream_gene_variant ; 389.0bp to feature; MODIFIER	silent_mutation	Average:55.563; most accessible tissue: Callus, score: 78.705	N	N	N	N
vg0922265212	C -> T	LOC_Os09g38740-LOC_Os09g38750	intergenic_region ; MODIFIER	silent_mutation	Average:55.563; most accessible tissue: Callus, score: 78.705	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922265212	NA	2.27E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	8.96E-06	NA	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	3.98E-07	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	1.29E-07	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	4.99E-08	NA	mr1119_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	6.02E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	7.66E-08	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	8.81E-06	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	2.34E-07	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	2.20E-08	NA	mr1247_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212	7.16E-07	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251