\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922265212:

Variant ID: vg0922265212 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22265212
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTTTAGGATTTGGTTTACAATTTGAAACTCTAACAACACCTTGGCTAGGAAGAGACCAAATTTGTTACTATCTCCGTTCTAAAATATCAGGAATTTTG[C/T]
TCATGTTAGAACGGGGCAGTATATTTTGTCATTGAGACCGAGACGTGAAACCTTTGTGATGAAGAAGACATTTTATCACAAGTATGATAAAGAACCATAA

Reverse complement sequence

TTATGGTTCTTTATCATACTTGTGATAAAATGTCTTCTTCATCACAAAGGTTTCACGTCTCGGTCTCAATGACAAAATATACTGCCCCGTTCTAACATGA[G/A]
CAAAATTCCTGATATTTTAGAACGGAGATAGTAACAAATTTGGTCTCTTCCTAGCCAAGGTGTTGTTAGAGTTTCAAATTGTAAACCAAATCCTAAACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 4.00% 0.06% 0.00% NA
All Indica  2759 97.10% 2.80% 0.07% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 61.70% 37.90% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.00% 7.50% 0.43% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 4.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922265212 C -> T LOC_Os09g38740.1 upstream_gene_variant ; 834.0bp to feature; MODIFIER silent_mutation Average:55.563; most accessible tissue: Callus, score: 78.705 N N N N
vg0922265212 C -> T LOC_Os09g38755.1 upstream_gene_variant ; 3890.0bp to feature; MODIFIER silent_mutation Average:55.563; most accessible tissue: Callus, score: 78.705 N N N N
vg0922265212 C -> T LOC_Os09g38730.1 downstream_gene_variant ; 3258.0bp to feature; MODIFIER silent_mutation Average:55.563; most accessible tissue: Callus, score: 78.705 N N N N
vg0922265212 C -> T LOC_Os09g38750.1 downstream_gene_variant ; 389.0bp to feature; MODIFIER silent_mutation Average:55.563; most accessible tissue: Callus, score: 78.705 N N N N
vg0922265212 C -> T LOC_Os09g38740-LOC_Os09g38750 intergenic_region ; MODIFIER silent_mutation Average:55.563; most accessible tissue: Callus, score: 78.705 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922265212 NA 2.27E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 8.96E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 3.98E-07 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 1.29E-07 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 4.99E-08 NA mr1119_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 6.02E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 7.66E-08 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 8.81E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 2.34E-07 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 2.20E-08 NA mr1247_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922265212 7.16E-07 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251