| Variant ID: vg0922265212 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22265212 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 62. )
CCGTTTAGGATTTGGTTTACAATTTGAAACTCTAACAACACCTTGGCTAGGAAGAGACCAAATTTGTTACTATCTCCGTTCTAAAATATCAGGAATTTTG[C/T]
TCATGTTAGAACGGGGCAGTATATTTTGTCATTGAGACCGAGACGTGAAACCTTTGTGATGAAGAAGACATTTTATCACAAGTATGATAAAGAACCATAA
TTATGGTTCTTTATCATACTTGTGATAAAATGTCTTCTTCATCACAAAGGTTTCACGTCTCGGTCTCAATGACAAAATATACTGCCCCGTTCTAACATGA[G/A]
CAAAATTCCTGATATTTTAGAACGGAGATAGTAACAAATTTGGTCTCTTCCTAGCCAAGGTGTTGTTAGAGTTTCAAATTGTAAACCAAATCCTAAACGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 4.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.10% | 2.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 61.70% | 37.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.00% | 7.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922265212 | C -> T | LOC_Os09g38740.1 | upstream_gene_variant ; 834.0bp to feature; MODIFIER | silent_mutation | Average:55.563; most accessible tissue: Callus, score: 78.705 | N | N | N | N |
| vg0922265212 | C -> T | LOC_Os09g38755.1 | upstream_gene_variant ; 3890.0bp to feature; MODIFIER | silent_mutation | Average:55.563; most accessible tissue: Callus, score: 78.705 | N | N | N | N |
| vg0922265212 | C -> T | LOC_Os09g38730.1 | downstream_gene_variant ; 3258.0bp to feature; MODIFIER | silent_mutation | Average:55.563; most accessible tissue: Callus, score: 78.705 | N | N | N | N |
| vg0922265212 | C -> T | LOC_Os09g38750.1 | downstream_gene_variant ; 389.0bp to feature; MODIFIER | silent_mutation | Average:55.563; most accessible tissue: Callus, score: 78.705 | N | N | N | N |
| vg0922265212 | C -> T | LOC_Os09g38740-LOC_Os09g38750 | intergenic_region ; MODIFIER | silent_mutation | Average:55.563; most accessible tissue: Callus, score: 78.705 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922265212 | NA | 2.27E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 8.96E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 3.98E-07 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 1.29E-07 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 4.99E-08 | NA | mr1119_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 6.02E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 7.66E-08 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 8.81E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 2.34E-07 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 2.20E-08 | NA | mr1247_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922265212 | 7.16E-07 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |