\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922183366:

Variant ID: vg0922183366 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22183366
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTACAACGACGTCAGTACCACCTTATATGCCAGTCTATTTATACTTTGCCAGTGAACTTCAATGTTTGGTGGGTTTCATACCTTATGCATAAGGTATTCA[A/G]
GTGCTTCACCAATCTTTGAAGACCACTCTGGATTTTTGCATGATGGAAATGTTCTCTGAGAATTCCATGTAGAAATAGATGACTTTATCATACTTGATCT

Reverse complement sequence

AGATCAAGTATGATAAAGTCATCTATTTCTACATGGAATTCTCAGAGAACATTTCCATCATGCAAAAATCCAGAGTGGTCTTCAAAGATTGGTGAAGCAC[T/C]
TGAATACCTTATGCATAAGGTATGAAACCCACCAAACATTGAAGTTCACTGGCAAAGTATAAATAGACTGGCATATAAGGTGGTACTGACGTCGTTGTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.60% 0.11% 0.00% NA
All Indica  2759 35.90% 63.90% 0.14% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 41.20% 58.70% 0.17% 0.00% NA
Indica II  465 31.60% 68.40% 0.00% 0.00% NA
Indica III  913 31.80% 68.00% 0.22% 0.00% NA
Indica Intermediate  786 39.30% 60.60% 0.13% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922183366 A -> G LOC_Os09g38570.1 upstream_gene_variant ; 4726.0bp to feature; MODIFIER silent_mutation Average:66.35; most accessible tissue: Minghui63 flower, score: 78.614 N N N N
vg0922183366 A -> G LOC_Os09g38560.1 downstream_gene_variant ; 76.0bp to feature; MODIFIER silent_mutation Average:66.35; most accessible tissue: Minghui63 flower, score: 78.614 N N N N
vg0922183366 A -> G LOC_Os09g38560-LOC_Os09g38570 intergenic_region ; MODIFIER silent_mutation Average:66.35; most accessible tissue: Minghui63 flower, score: 78.614 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922183366 NA 2.21E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 3.75E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 3.59E-06 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 1.24E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 6.57E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 2.23E-08 mr1329_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 4.55E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 8.06E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 2.54E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 8.25E-11 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 3.48E-07 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 1.16E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 5.93E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 7.52E-08 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 1.10E-06 2.97E-06 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 6.39E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922183366 NA 2.06E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251