\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922167953:

Variant ID: vg0922167953 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22167953
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCGAAATTTAAGGCTACGTTCGTTCCCCAGGGTTTCCAACTCCCCACCCTCATTTTCGTGCGTACGCTTTTCAAACTACTAAACGGTGTGTTTTTTT[G/A]
CAAAAAGTTTCTATACAAAAGTTGTTTAAAAAATCATATTAATCTATTCTTTAAAAAATAGCTAATATTTAATTAATCACACGTTAATGCGAACATCGTT

Reverse complement sequence

AACGATGTTCGCATTAACGTGTGATTAATTAAATATTAGCTATTTTTTAAAGAATAGATTAATATGATTTTTTAAACAACTTTTGTATAGAAACTTTTTG[C/T]
AAAAAAACACACCGTTTAGTAGTTTGAAAAGCGTACGCACGAAAATGAGGGTGGGGAGTTGGAAACCCTGGGGAACGAACGTAGCCTTAAATTTCGGTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.40% 0.11% 0.00% NA
All Indica  2759 46.00% 53.90% 0.14% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 72.90% 26.80% 0.37% 0.00% NA
Indica I  595 40.50% 59.30% 0.17% 0.00% NA
Indica II  465 45.80% 54.20% 0.00% 0.00% NA
Indica III  913 50.60% 49.40% 0.00% 0.00% NA
Indica Intermediate  786 44.90% 54.70% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922167953 G -> A LOC_Os09g38520.1 upstream_gene_variant ; 4149.0bp to feature; MODIFIER silent_mutation Average:77.137; most accessible tissue: Callus, score: 89.273 N N N N
vg0922167953 G -> A LOC_Os09g38530.1 upstream_gene_variant ; 493.0bp to feature; MODIFIER silent_mutation Average:77.137; most accessible tissue: Callus, score: 89.273 N N N N
vg0922167953 G -> A LOC_Os09g38540.1 upstream_gene_variant ; 4887.0bp to feature; MODIFIER silent_mutation Average:77.137; most accessible tissue: Callus, score: 89.273 N N N N
vg0922167953 G -> A LOC_Os09g38520-LOC_Os09g38530 intergenic_region ; MODIFIER silent_mutation Average:77.137; most accessible tissue: Callus, score: 89.273 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922167953 NA 1.83E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 9.70E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 1.66E-10 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 1.60E-09 1.61E-09 mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 3.39E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 6.95E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 6.56E-06 mr1520_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 3.79E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 1.49E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 5.97E-06 1.80E-08 mr1629_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 4.61E-08 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 3.50E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 7.44E-11 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 7.08E-10 1.13E-10 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922167953 NA 2.70E-08 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251