| Variant ID: vg0922086583 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 22086583 |
| Reference Allele: T | Alternative Allele: A,TAAA,TA |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.05, others allele: 0.00, population size: 109. )
TCCTTAAGGGTTTACAATGTCCCATCGTACACATTTTCTTCCAAATTCATTGCAAAATAGTTATTTTTTTAAAAAAAAGTAGAATAGTTGTATTCTTTTT[T/A,TAAA,TA]
AAAAAATGATAATATACGGTATAGGGAAATATTGAAATATACCACTCTACATTGAGAGGGAAAAAATAAATTCAGATATAAATAGTACACTACTACTTTT
AAAAGTAGTAGTGTACTATTTATATCTGAATTTATTTTTTCCCTCTCAATGTAGAGTGGTATATTTCAATATTTCCCTATACCGTATATTATCATTTTTT[A/T,TTTA,TA]
AAAAAGAATACAACTATTCTACTTTTTTTTAAAAAAATAACTATTTTGCAATGAATTTGGAAGAAAATGTGTACGATGGGACATTGTAAACCCTTAAGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.40% | 40.10% | 0.38% | 0.00% | TAAA: 0.11%; TA: 0.04% |
| All Indica | 2759 | 93.30% | 6.10% | 0.58% | 0.00% | TAAA: 0.04% |
| All Japonica | 1512 | 0.50% | 99.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 73.20% | 25.30% | 0.00% | 0.00% | TAAA: 1.49% |
| Indica I | 595 | 98.20% | 0.80% | 1.01% | 0.00% | NA |
| Indica II | 465 | 87.50% | 11.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 93.60% | 5.90% | 0.33% | 0.00% | TAAA: 0.11% |
| Indica Intermediate | 786 | 92.70% | 6.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 25.60% | 71.10% | 1.11% | 0.00% | TA: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922086583 | T -> TAAA | LOC_Os09g38350.1 | upstream_gene_variant ; 1687.0bp to feature; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0922086583 | T -> TAAA | LOC_Os09g38360.1 | upstream_gene_variant ; 3695.0bp to feature; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0922086583 | T -> TAAA | LOC_Os09g38350-LOC_Os09g38360 | intergenic_region ; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0922086583 | T -> TA | LOC_Os09g38350.1 | upstream_gene_variant ; 1687.0bp to feature; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0922086583 | T -> TA | LOC_Os09g38360.1 | upstream_gene_variant ; 3695.0bp to feature; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0922086583 | T -> TA | LOC_Os09g38350-LOC_Os09g38360 | intergenic_region ; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0922086583 | T -> A | LOC_Os09g38350.1 | upstream_gene_variant ; 1686.0bp to feature; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0922086583 | T -> A | LOC_Os09g38360.1 | upstream_gene_variant ; 3696.0bp to feature; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0922086583 | T -> A | LOC_Os09g38350-LOC_Os09g38360 | intergenic_region ; MODIFIER | silent_mutation | Average:34.558; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922086583 | 1.19E-06 | 3.90E-06 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922086583 | 2.88E-10 | 2.22E-80 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922086583 | 5.38E-09 | 1.28E-08 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922086583 | NA | 9.28E-16 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922086583 | 4.24E-08 | 4.68E-40 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922086583 | NA | 3.44E-22 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922086583 | NA | 1.29E-18 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922086583 | 5.59E-10 | 1.42E-95 | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922086583 | 4.92E-07 | 7.69E-09 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |