Variant ID: vg0921852094 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 21852094 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 116. )
GGAGCCGATGTCTTCCCCAGCCACCGCCGAAGCTGTGGTCTTCCCCATCCGGCGCCGCCGAACTCCACCGATGCCGCATGCCACCCTGCTGAGGACCTCC[G/A]
ACATCGTCATCGTCTCCTCCCCAACATGCACTCCTGCCTCCCCAGCCATCCCAGAACTGCCGCAGACCTTCGACACAAATGGCCTCAACCTCCTCCTGTT
AACAGGAGGAGGTTGAGGCCATTTGTGTCGAAGGTCTGCGGCAGTTCTGGGATGGCTGGGGAGGCAGGAGTGCATGTTGGGGAGGAGACGATGACGATGT[C/T]
GGAGGTCCTCAGCAGGGTGGCATGCGGCATCGGTGGAGTTCGGCGGCGCCGGATGGGGAAGACCACAGCTTCGGCGGTGGCTGGGGAAGACATCGGCTCC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 41.20% | 1.70% | 0.78% | 56.33% | NA |
All Indica | 2759 | 8.30% | 2.60% | 1.12% | 88.00% | NA |
All Japonica | 1512 | 99.50% | 0.10% | 0.00% | 0.40% | NA |
Aus | 269 | 27.50% | 1.90% | 1.86% | 68.77% | NA |
Indica I | 595 | 1.80% | 1.20% | 1.34% | 95.63% | NA |
Indica II | 465 | 21.70% | 3.70% | 0.43% | 74.19% | NA |
Indica III | 913 | 6.50% | 2.20% | 1.31% | 90.03% | NA |
Indica Intermediate | 786 | 7.40% | 3.40% | 1.15% | 88.04% | NA |
Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
VI/Aromatic | 96 | 85.40% | 1.00% | 0.00% | 13.54% | NA |
Intermediate | 90 | 65.60% | 0.00% | 1.11% | 33.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0921852094 | G -> DEL | N | N | silent_mutation | Average:56.567; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
vg0921852094 | G -> A | LOC_Os09g37890.1 | upstream_gene_variant ; 2076.0bp to feature; MODIFIER | silent_mutation | Average:56.567; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
vg0921852094 | G -> A | LOC_Os09g37910.1 | upstream_gene_variant ; 4778.0bp to feature; MODIFIER | silent_mutation | Average:56.567; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
vg0921852094 | G -> A | LOC_Os09g37890-LOC_Os09g37910 | intergenic_region ; MODIFIER | silent_mutation | Average:56.567; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0921852094 | 5.35E-07 | 5.55E-72 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 1.09E-14 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 5.88E-16 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 5.53E-13 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 1.14E-12 | mr1258_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 5.32E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 3.50E-21 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 8.62E-13 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 4.91E-11 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 2.79E-18 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | 2.56E-06 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 2.96E-34 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0921852094 | NA | 4.78E-21 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |