\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921540025:

Variant ID: vg0921540025 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21540025
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.04, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGATGAAGTGGTCGAAGAGTTCAAAGGATGCAAATGGCAGTCAATCAAAAGTGATTTATATTGTTCTGCGGTATTCTGATGGTCTGACCAAACACTCC[A/T]
GCTGGTGTGGATGAACACTGGTAGATGAGGGACACTATGAATAATAAACTTGATACTTGCATAGGATGAAACGGGAAAAAAAAGATTCACCATAGCATAT

Reverse complement sequence

ATATGCTATGGTGAATCTTTTTTTTCCCGTTTCATCCTATGCAAGTATCAAGTTTATTATTCATAGTGTCCCTCATCTACCAGTGTTCATCCACACCAGC[T/A]
GGAGTGTTTGGTCAGACCATCAGAATACCGCAGAACAATATAAATCACTTTTGATTGACTGCCATTTGCATCCTTTGAACTCTTCGACCACTTCATCAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 19.30% 0.25% 0.13% NA
All Indica  2759 67.30% 32.10% 0.40% 0.18% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.07% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 85.70% 13.90% 0.17% 0.17% NA
Indica II  465 63.90% 34.80% 0.86% 0.43% NA
Indica III  913 59.30% 40.50% 0.11% 0.11% NA
Indica Intermediate  786 64.60% 34.60% 0.64% 0.13% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921540025 A -> DEL N N silent_mutation Average:52.0; most accessible tissue: Callus, score: 83.718 N N N N
vg0921540025 A -> T LOC_Os09g37290.1 downstream_gene_variant ; 3849.0bp to feature; MODIFIER silent_mutation Average:52.0; most accessible tissue: Callus, score: 83.718 N N N N
vg0921540025 A -> T LOC_Os09g37300.1 downstream_gene_variant ; 4323.0bp to feature; MODIFIER silent_mutation Average:52.0; most accessible tissue: Callus, score: 83.718 N N N N
vg0921540025 A -> T LOC_Os09g37280.1 intron_variant ; MODIFIER silent_mutation Average:52.0; most accessible tissue: Callus, score: 83.718 N N N N
vg0921540025 A -> T LOC_Os09g37280.2 intron_variant ; MODIFIER silent_mutation Average:52.0; most accessible tissue: Callus, score: 83.718 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921540025 7.73E-09 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 1.25E-07 3.60E-08 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 NA 2.39E-08 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 NA 9.03E-08 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 8.17E-08 5.20E-12 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 1.59E-06 1.05E-11 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 4.28E-07 7.60E-12 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 5.79E-06 4.26E-11 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 1.92E-08 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 1.43E-07 5.97E-09 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 7.33E-08 1.72E-12 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 1.07E-06 3.00E-12 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 2.62E-07 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 1.52E-07 2.97E-10 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 7.87E-11 1.78E-16 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 9.57E-09 1.46E-11 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 1.81E-11 2.37E-15 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 1.32E-09 8.38E-15 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 NA 9.34E-06 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 NA 9.19E-06 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 4.20E-14 NA mr1051_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 3.45E-12 3.56E-14 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 3.41E-09 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 4.87E-09 2.98E-12 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 5.43E-06 3.17E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921540025 NA 7.62E-07 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251