\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921537073:

Variant ID: vg0921537073 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21537073
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAACTTCGATGAGAAAATCTCAAGATCAGCTTTAAATTTAAGGTTAAAAATTCAAAATTTGGCTGATAAAACATAAACATAAGCGAAAAGATGGGGCT[G/A]
GAACATGTAGGTTTTGCCTGCATTGACGAAACCTGTCGTGTCGAGTGAAGTCGTGTCACCGGTAGATCACGAATGGGCAGCGAGATTTCGGAGCATCTTT

Reverse complement sequence

AAAGATGCTCCGAAATCTCGCTGCCCATTCGTGATCTACCGGTGACACGACTTCACTCGACACGACAGGTTTCGTCAATGCAGGCAAAACCTACATGTTC[C/T]
AGCCCCATCTTTTCGCTTATGTTTATGTTTTATCAGCCAAATTTTGAATTTTTAACCTTAAATTTAAAGCTGATCTTGAGATTTTCTCATCGAAGTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 40.70% 0.34% 0.00% NA
All Indica  2759 35.00% 64.80% 0.18% 0.00% NA
All Japonica  1512 96.30% 3.10% 0.60% 0.00% NA
Aus  269 76.60% 22.70% 0.74% 0.00% NA
Indica I  595 15.50% 84.50% 0.00% 0.00% NA
Indica II  465 38.10% 61.30% 0.65% 0.00% NA
Indica III  913 41.80% 58.20% 0.00% 0.00% NA
Indica Intermediate  786 40.20% 59.50% 0.25% 0.00% NA
Temperate Japonica  767 98.60% 1.00% 0.39% 0.00% NA
Tropical Japonica  504 98.40% 1.20% 0.40% 0.00% NA
Japonica Intermediate  241 84.60% 13.70% 1.66% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921537073 G -> A LOC_Os09g37280.1 downstream_gene_variant ; 915.0bp to feature; MODIFIER silent_mutation Average:48.517; most accessible tissue: Callus, score: 74.153 N N N N
vg0921537073 G -> A LOC_Os09g37280.2 downstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:48.517; most accessible tissue: Callus, score: 74.153 N N N N
vg0921537073 G -> A LOC_Os09g37270-LOC_Os09g37280 intergenic_region ; MODIFIER silent_mutation Average:48.517; most accessible tissue: Callus, score: 74.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921537073 1.26E-06 1.58E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 2.99E-07 7.96E-08 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 NA 3.85E-07 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 NA 1.37E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 8.37E-06 1.99E-10 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 NA 3.97E-10 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 2.76E-06 3.75E-25 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 9.31E-07 3.80E-08 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 NA 6.65E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 7.43E-06 6.92E-11 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 6.07E-07 3.00E-10 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 7.88E-09 NA mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 1.45E-07 2.83E-11 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 8.08E-10 8.19E-07 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 1.65E-09 2.37E-14 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 NA 5.77E-06 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 NA 8.50E-06 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 1.62E-12 2.54E-36 mr1051_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 2.97E-12 6.17E-14 mr1051_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 1.33E-08 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 2.09E-09 8.58E-14 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921537073 NA 1.01E-06 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251