\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921522197:

Variant ID: vg0921522197 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21522197
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AATCATGCATACTCATATTTGTCAAATGCTATATGCTTGGGCAATTATCTTTGGGAAGGTAATTGAGATGCGGCATGTGGAGACATGAGCGCCACATTGC[C/T]
ATGATATTGAGGACATGATTTGTGAAAGGAGAAATAAACTAAATAACTATTTTCGACTGGGGTGGACGGAGGATTTGGGTGGTATCTGGAAAAGGCTAGT

Reverse complement sequence

ACTAGCCTTTTCCAGATACCACCCAAATCCTCCGTCCACCCCAGTCGAAAATAGTTATTTAGTTTATTTCTCCTTTCACAAATCATGTCCTCAATATCAT[G/A]
GCAATGTGGCGCTCATGTCTCCACATGCCGCATCTCAATTACCTTCCCAAAGATAATTGCCCAAGCATATAGCATTTGACAAATATGAGTATGCATGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 39.30% 1.90% 0.51% NA
All Indica  2759 30.90% 65.20% 3.12% 0.83% NA
All Japonica  1512 99.50% 0.40% 0.07% 0.00% NA
Aus  269 84.80% 14.90% 0.37% 0.00% NA
Indica I  595 9.10% 84.40% 6.55% 0.00% NA
Indica II  465 28.40% 63.70% 5.16% 2.80% NA
Indica III  913 40.90% 58.10% 0.55% 0.55% NA
Indica Intermediate  786 37.30% 59.80% 2.29% 0.64% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 16.70% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921522197 C -> DEL N N silent_mutation Average:20.116; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0921522197 C -> T LOC_Os09g37250.1 upstream_gene_variant ; 4576.0bp to feature; MODIFIER silent_mutation Average:20.116; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0921522197 C -> T LOC_Os09g37260.1 downstream_gene_variant ; 2172.0bp to feature; MODIFIER silent_mutation Average:20.116; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0921522197 C -> T LOC_Os09g37270.1 downstream_gene_variant ; 3753.0bp to feature; MODIFIER silent_mutation Average:20.116; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0921522197 C -> T LOC_Os09g37270.2 downstream_gene_variant ; 3779.0bp to feature; MODIFIER silent_mutation Average:20.116; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0921522197 C -> T LOC_Os09g37250-LOC_Os09g37260 intergenic_region ; MODIFIER silent_mutation Average:20.116; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921522197 NA 1.68E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 7.34E-06 3.81E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 NA 3.51E-07 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 NA 1.57E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 NA 3.71E-10 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 NA 8.71E-10 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 NA 2.56E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 NA 1.21E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 NA 4.82E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 5.13E-06 5.27E-11 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 3.01E-06 4.82E-09 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 3.90E-09 NA mr1004_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 4.19E-08 5.73E-12 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 1.77E-08 7.18E-07 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 2.68E-08 1.29E-14 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 NA 2.16E-07 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 3.26E-08 5.72E-33 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 2.01E-08 4.72E-11 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 1.68E-07 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 2.37E-08 6.60E-13 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 1.82E-06 NA mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921522197 6.08E-07 1.09E-08 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251