\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921456248:

Variant ID: vg0921456248 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21456248
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CGATCATAAAGCGCAGCTTAATCGGAGGTATTCCATAGGCTCGTCCTGTAGATGTAATTAATCGATAGCCTCATTGCTAGGCATCGGAAATCAGCGGACT[G/A]
CACGCAATCTCCAGTCAGCATACCTTTTTATTAAGCATTCCTCGCGAAGGCAAAAGGCGAACTTCTGCGGGAGCCCTCATGTATTTGTAAACATTTATGT

Reverse complement sequence

ACATAAATGTTTACAAATACATGAGGGCTCCCGCAGAAGTTCGCCTTTTGCCTTCGCGAGGAATGCTTAATAAAAAGGTATGCTGACTGGAGATTGCGTG[C/T]
AGTCCGCTGATTTCCGATGCCTAGCAATGAGGCTATCGATTAATTACATCTACAGGACGAGCCTATGGAATACCTCCGATTAAGCTGCGCTTTATGATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 45.30% 0.42% 0.00% NA
All Indica  2759 39.50% 60.10% 0.40% 0.00% NA
All Japonica  1512 76.00% 23.40% 0.60% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 28.60% 71.30% 0.17% 0.00% NA
Indica II  465 35.90% 63.40% 0.65% 0.00% NA
Indica III  913 48.60% 50.80% 0.55% 0.00% NA
Indica Intermediate  786 39.30% 60.40% 0.25% 0.00% NA
Temperate Japonica  767 90.70% 8.70% 0.52% 0.00% NA
Tropical Japonica  504 46.00% 53.20% 0.79% 0.00% NA
Japonica Intermediate  241 91.70% 7.90% 0.41% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921456248 G -> A LOC_Os09g37180.1 downstream_gene_variant ; 3600.0bp to feature; MODIFIER silent_mutation Average:45.088; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0921456248 G -> A LOC_Os09g37180-LOC_Os09g37200 intergenic_region ; MODIFIER silent_mutation Average:45.088; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921456248 NA 2.48E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 5.74E-06 4.27E-13 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 9.09E-08 1.26E-14 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 6.75E-10 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 5.40E-07 1.41E-13 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 1.61E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 3.52E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 3.49E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 3.82E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 2.00E-08 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 4.98E-06 2.99E-13 mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 7.90E-08 4.33E-15 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 1.26E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 5.11E-06 5.11E-06 mr1466 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 6.32E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 2.93E-11 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 6.45E-11 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 1.05E-06 8.67E-09 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 4.52E-07 3.35E-10 mr1006_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 3.35E-11 1.07E-17 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 4.42E-06 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 8.04E-07 NA mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 1.57E-09 1.45E-13 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 NA 9.80E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 1.41E-07 2.63E-14 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456248 5.72E-06 2.20E-07 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251