\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921456103:

Variant ID: vg0921456103 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21456103
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAATTCTCTCCGCACTCCGACGTGGTGGTGGTGTACTGTGACCGGGTTTTGGCGAAACAAAGCTACTTGTTCCACATTCACTATATTCACCGTTAAAT[C/A,T]
TGCACCAACCTCAACCTTCGGCGAGCAAACAACTTTGAAGACGACGATCATAAAGCGCAGCTTAATCGGAGGTATTCCATAGGCTCGTCCTGTAGATGTA

Reverse complement sequence

TACATCTACAGGACGAGCCTATGGAATACCTCCGATTAAGCTGCGCTTTATGATCGTCGTCTTCAAAGTTGTTTGCTCGCCGAAGGTTGAGGTTGGTGCA[G/T,A]
ATTTAACGGTGAATATAGTGAATGTGGAACAAGTAGCTTTGTTTCGCCAAAACCCGGTCACAGTACACCACCACCACGTCGGAGTGCGGAGAGAATTTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 8.00% 3.15% 2.41% NA
All Indica  2759 77.90% 13.30% 4.71% 4.13% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 91.10% 3.30% 5.58% 0.00% NA
Indica I  595 96.10% 3.00% 0.84% 0.00% NA
Indica II  465 78.70% 14.20% 3.44% 3.66% NA
Indica III  913 68.80% 17.10% 7.34% 6.79% NA
Indica Intermediate  786 74.00% 16.20% 5.34% 4.45% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921456103 C -> DEL N N silent_mutation Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0921456103 C -> T LOC_Os09g37180.1 downstream_gene_variant ; 3455.0bp to feature; MODIFIER N Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0921456103 C -> T LOC_Os09g37180-LOC_Os09g37200 intergenic_region ; MODIFIER N Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0921456103 C -> A LOC_Os09g37180.1 downstream_gene_variant ; 3455.0bp to feature; MODIFIER silent_mutation Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0921456103 C -> A LOC_Os09g37180-LOC_Os09g37200 intergenic_region ; MODIFIER silent_mutation Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921456103 1.89E-07 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.54E-06 4.61E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 NA 1.71E-08 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 NA 1.57E-07 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 4.73E-17 4.48E-23 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.17E-15 1.13E-21 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 6.85E-15 1.33E-20 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 6.17E-15 1.75E-20 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 NA 2.50E-06 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 NA 1.42E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 5.80E-08 NA mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 9.57E-09 2.37E-12 mr1037 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 3.84E-08 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.62E-07 1.72E-07 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 7.56E-18 1.63E-24 mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.27E-16 4.08E-23 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 NA 3.61E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 3.04E-09 1.58E-15 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 2.12E-07 3.69E-11 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 2.53E-19 4.31E-25 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.37E-15 1.65E-22 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 NA 1.54E-08 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 NA 4.39E-08 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 3.63E-11 NA mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.48E-09 1.21E-10 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 2.43E-06 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 2.85E-06 1.03E-08 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.19E-07 NA mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.90E-06 1.50E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 1.74E-12 1.80E-18 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103 4.27E-11 7.78E-13 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251