Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921456103:

Variant ID: vg0921456103 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21456103
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAATTCTCTCCGCACTCCGACGTGGTGGTGGTGTACTGTGACCGGGTTTTGGCGAAACAAAGCTACTTGTTCCACATTCACTATATTCACCGTTAAAT[C/A,T]
TGCACCAACCTCAACCTTCGGCGAGCAAACAACTTTGAAGACGACGATCATAAAGCGCAGCTTAATCGGAGGTATTCCATAGGCTCGTCCTGTAGATGTA

Reverse complement sequence

TACATCTACAGGACGAGCCTATGGAATACCTCCGATTAAGCTGCGCTTTATGATCGTCGTCTTCAAAGTTGTTTGCTCGCCGAAGGTTGAGGTTGGTGCA[G/T,A]
ATTTAACGGTGAATATAGTGAATGTGGAACAAGTAGCTTTGTTTCGCCAAAACCCGGTCACAGTACACCACCACCACGTCGGAGTGCGGAGAGAATTTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.40%	8.00%	3.15%	2.41%	NA
All Indica	2759	77.90%	13.30%	4.71%	4.13%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	91.10%	3.30%	5.58%	0.00%	NA
Indica I	595	96.10%	3.00%	0.84%	0.00%	NA
Indica II	465	78.70%	14.20%	3.44%	3.66%	NA
Indica III	913	68.80%	17.10%	7.34%	6.79%	NA
Indica Intermediate	786	74.00%	16.20%	5.34%	4.45%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	4.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921456103	C -> DEL	N	N	silent_mutation	Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0921456103	C -> T	LOC_Os09g37180.1	downstream_gene_variant ; 3455.0bp to feature; MODIFIER	N	Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0921456103	C -> T	LOC_Os09g37180-LOC_Os09g37200	intergenic_region ; MODIFIER	N	Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0921456103	C -> A	LOC_Os09g37180.1	downstream_gene_variant ; 3455.0bp to feature; MODIFIER	silent_mutation	Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0921456103	C -> A	LOC_Os09g37180-LOC_Os09g37200	intergenic_region ; MODIFIER	silent_mutation	Average:35.829; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921456103	1.89E-07	NA	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.54E-06	4.61E-06	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	NA	1.71E-08	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	NA	1.57E-07	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	4.73E-17	4.48E-23	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.17E-15	1.13E-21	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	6.85E-15	1.33E-20	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	6.17E-15	1.75E-20	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	NA	2.50E-06	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	NA	1.42E-06	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	5.80E-08	NA	mr1037	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	9.57E-09	2.37E-12	mr1037	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	3.84E-08	NA	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.62E-07	1.72E-07	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	7.56E-18	1.63E-24	mr1052	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.27E-16	4.08E-23	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	NA	3.61E-07	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	3.04E-09	1.58E-15	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	2.12E-07	3.69E-11	mr1004_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	2.53E-19	4.31E-25	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.37E-15	1.65E-22	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	NA	1.54E-08	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	NA	4.39E-08	mr1037_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	3.63E-11	NA	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.48E-09	1.21E-10	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	2.43E-06	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	2.85E-06	1.03E-08	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.19E-07	NA	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.90E-06	1.50E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	1.74E-12	1.80E-18	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456103	4.27E-11	7.78E-13	mr1986_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251