\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921454670:

Variant ID: vg0921454670 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21454670
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGAGTGCGATGAAAATCAAATCGTATCTGCTTTTTCTTGAAACATAAACTTGATATGTCTAATCTACGGATCGGACTATCCTCGTATTTTTTATAAT[C/T]
AAAACATATGTTTTTACGGTGCACATACCGGGGGCGAGCCCCAAATTATAAAACAAGGGAAGGAGATGGGAGAAAATCCCCGGCGCAGAGGCGGCTGGCA

Reverse complement sequence

TGCCAGCCGCCTCTGCGCCGGGGATTTTCTCCCATCTCCTTCCCTTGTTTTATAATTTGGGGCTCGCCCCCGGTATGTGCACCGTAAAAACATATGTTTT[G/A]
ATTATAAAAAATACGAGGATAGTCCGATCCGTAGATTAGACATATCAAGTTTATGTTTCAAGAAAAAGCAGATACGATTTGATTTTCATCGCACTCTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 8.80% 0.83% 3.53% NA
All Indica  2759 78.50% 14.20% 1.34% 5.94% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 91.10% 8.20% 0.00% 0.74% NA
Indica I  595 96.50% 1.80% 0.67% 1.01% NA
Indica II  465 80.40% 12.90% 1.08% 5.59% NA
Indica III  913 68.80% 20.40% 1.31% 9.53% NA
Indica Intermediate  786 75.20% 17.00% 2.04% 5.73% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921454670 C -> DEL N N silent_mutation Average:63.259; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0921454670 C -> T LOC_Os09g37180.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER silent_mutation Average:63.259; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0921454670 C -> T LOC_Os09g37180-LOC_Os09g37200 intergenic_region ; MODIFIER silent_mutation Average:63.259; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921454670 1.31E-06 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 5.47E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 1.01E-08 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 4.21E-09 mr1004 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 1.34E-06 mr1005 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.83E-12 3.84E-20 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.96E-12 9.02E-20 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 3.37E-12 3.20E-19 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.09E-12 1.87E-19 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 4.75E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 5.02E-07 NA mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.04E-06 5.73E-11 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.22E-06 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 5.34E-06 8.85E-08 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 2.56E-12 8.84E-21 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 2.61E-12 2.52E-20 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 3.24E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 2.82E-09 8.98E-15 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.10E-07 6.95E-11 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.19E-17 1.04E-23 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.55E-15 2.06E-22 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 1.87E-08 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 6.59E-06 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 5.74E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.49E-06 NA mr1037_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 NA 1.44E-08 mr1037_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 4.41E-10 NA mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 1.18E-08 8.79E-11 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 5.54E-06 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 4.46E-06 5.18E-08 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 2.27E-08 1.64E-13 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454670 2.51E-07 3.24E-09 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251