\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921387658:

Variant ID: vg0921387658 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21387658
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGAATGCGGTACGTGATTCATGGACCTGAATATGCGGCTATATATCTTTTTAGCGTTCCAAAGAAGCAAGCTAGTACTAATATGCATGATTACACCAA[G/A]
TTTTTCGTCATCTTTTTATGCGCGACAGCATCATCAGCTAGCACTTGTTCGTTTCATACAATTCATCTCCATGTCTGTAATTAAATTGCTGATGTCATTT

Reverse complement sequence

AAATGACATCAGCAATTTAATTACAGACATGGAGATGAATTGTATGAAACGAACAAGTGCTAGCTGATGATGCTGTCGCGCATAAAAAGATGACGAAAAA[C/T]
TTGGTGTAATCATGCATATTAGTACTAGCTTGCTTCTTTGGAACGCTAAAAAGATATATAGCCGCATATTCAGGTCCATGAATCACGTACCGCATTCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 2.20% 0.42% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 92.10% 6.70% 1.19% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 90.70% 7.70% 1.56% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 81.70% 15.80% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921387658 G -> A LOC_Os09g37070.1 upstream_gene_variant ; 4339.0bp to feature; MODIFIER silent_mutation Average:82.9; most accessible tissue: Zhenshan97 root, score: 96.17 N N N N
vg0921387658 G -> A LOC_Os09g37090.1 upstream_gene_variant ; 2657.0bp to feature; MODIFIER silent_mutation Average:82.9; most accessible tissue: Zhenshan97 root, score: 96.17 N N N N
vg0921387658 G -> A LOC_Os09g37100.1 upstream_gene_variant ; 4116.0bp to feature; MODIFIER silent_mutation Average:82.9; most accessible tissue: Zhenshan97 root, score: 96.17 N N N N
vg0921387658 G -> A LOC_Os09g37080.1 downstream_gene_variant ; 493.0bp to feature; MODIFIER silent_mutation Average:82.9; most accessible tissue: Zhenshan97 root, score: 96.17 N N N N
vg0921387658 G -> A LOC_Os09g37080-LOC_Os09g37090 intergenic_region ; MODIFIER silent_mutation Average:82.9; most accessible tissue: Zhenshan97 root, score: 96.17 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921387658 G A 0.02 0.02 0.04 0.0 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921387658 5.17E-06 5.17E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 6.43E-06 4.31E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 2.06E-06 2.05E-06 mr1122 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 2.09E-07 1.01E-07 mr1152 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 6.95E-06 1.95E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 6.82E-06 5.00E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 5.75E-06 9.99E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 1.78E-06 1.78E-06 mr1750 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 1.60E-07 7.44E-07 mr1889 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 2.36E-08 2.30E-09 mr1896 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 5.93E-07 5.93E-07 mr1934 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921387658 6.14E-10 6.13E-10 mr1935 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251