Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0921023184:

Variant ID: vg0921023184 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21023184
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTTTAGTCTAATGAAATTGGATAGTTTAGGTGGATGGTTGGGCTTGTTGCAACGTGGGATAGCGTTGGACAGCAGATGATTAATATTGATTAATTATT[G/A]
CGACTGTTTTTTTCTTTAAACTTCTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTCTAGCTCTCCTATGATAATTCCCTGCATCATACCCCTATT

Reverse complement sequence

AATAGGGGTATGATGCAGGGAATTATCATAGGAGAGCTAGAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGAAGTTTAAAGAAAAAAACAGTCG[C/T]
AATAATTAATCAATATTAATCATCTGCTGTCCAACGCTATCCCACGTTGCAACAAGCCCAACCATCCACCTAAACTATCCAATTTCATTAGACTAAACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	5.60%	40.82%	4.02%	NA
All Indica	2759	21.10%	9.60%	62.60%	6.78%	NA
All Japonica	1512	99.70%	0.00%	0.26%	0.00%	NA
Aus	269	34.60%	0.00%	65.06%	0.37%	NA
Indica I	595	13.80%	4.70%	73.61%	7.90%	NA
Indica II	465	8.00%	16.30%	62.80%	12.90%	NA
Indica III	913	27.70%	10.70%	58.71%	2.85%	NA
Indica Intermediate	786	26.60%	7.90%	58.65%	6.87%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	0.00%	6.25%	0.00%	NA
Intermediate	90	77.80%	1.10%	18.89%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921023184	G -> DEL	N	N	silent_mutation	Average:17.314; most accessible tissue: Callus, score: 38.983	N	N	N	N
vg0921023184	G -> A	LOC_Os09g36420.1	downstream_gene_variant ; 3179.0bp to feature; MODIFIER	silent_mutation	Average:17.314; most accessible tissue: Callus, score: 38.983	N	N	N	N
vg0921023184	G -> A	LOC_Os09g36430.1	downstream_gene_variant ; 3072.0bp to feature; MODIFIER	silent_mutation	Average:17.314; most accessible tissue: Callus, score: 38.983	N	N	N	N
vg0921023184	G -> A	LOC_Os09g36420-LOC_Os09g36430	intergenic_region ; MODIFIER	silent_mutation	Average:17.314; most accessible tissue: Callus, score: 38.983	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921023184	NA	5.77E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184	NA	1.23E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184	NA	6.93E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184	NA	2.78E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184	NA	4.34E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184	NA	9.63E-07	mr1971_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251