\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921023184:

Variant ID: vg0921023184 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21023184
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTTTAGTCTAATGAAATTGGATAGTTTAGGTGGATGGTTGGGCTTGTTGCAACGTGGGATAGCGTTGGACAGCAGATGATTAATATTGATTAATTATT[G/A]
CGACTGTTTTTTTCTTTAAACTTCTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTCTAGCTCTCCTATGATAATTCCCTGCATCATACCCCTATT

Reverse complement sequence

AATAGGGGTATGATGCAGGGAATTATCATAGGAGAGCTAGAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGAAGTTTAAAGAAAAAAACAGTCG[C/T]
AATAATTAATCAATATTAATCATCTGCTGTCCAACGCTATCCCACGTTGCAACAAGCCCAACCATCCACCTAAACTATCCAATTTCATTAGACTAAACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 5.60% 40.82% 4.02% NA
All Indica  2759 21.10% 9.60% 62.60% 6.78% NA
All Japonica  1512 99.70% 0.00% 0.26% 0.00% NA
Aus  269 34.60% 0.00% 65.06% 0.37% NA
Indica I  595 13.80% 4.70% 73.61% 7.90% NA
Indica II  465 8.00% 16.30% 62.80% 12.90% NA
Indica III  913 27.70% 10.70% 58.71% 2.85% NA
Indica Intermediate  786 26.60% 7.90% 58.65% 6.87% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 0.00% 6.25% 0.00% NA
Intermediate  90 77.80% 1.10% 18.89% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921023184 G -> DEL N N silent_mutation Average:17.314; most accessible tissue: Callus, score: 38.983 N N N N
vg0921023184 G -> A LOC_Os09g36420.1 downstream_gene_variant ; 3179.0bp to feature; MODIFIER silent_mutation Average:17.314; most accessible tissue: Callus, score: 38.983 N N N N
vg0921023184 G -> A LOC_Os09g36430.1 downstream_gene_variant ; 3072.0bp to feature; MODIFIER silent_mutation Average:17.314; most accessible tissue: Callus, score: 38.983 N N N N
vg0921023184 G -> A LOC_Os09g36420-LOC_Os09g36430 intergenic_region ; MODIFIER silent_mutation Average:17.314; most accessible tissue: Callus, score: 38.983 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921023184 NA 5.77E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184 NA 1.23E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184 NA 6.93E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184 NA 2.78E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184 NA 4.34E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921023184 NA 9.63E-07 mr1971_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251