\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920282336:

Variant ID: vg0920282336 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20282336
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGAAAAATTTATAAATAAAAAATAAAAAAATTAGTCACACATAAAATACTATTCATATTTTATCATCTAATAACAACAAAAATACTAATCATAAAAA[A/T]
TTTTCAAATAAGACTAACGGTTAAAACTTAACACATAAACATATCAAAAATATATTTATTTCAGGACGGAGAGAGTACGTGAGGATCTACAACAATCAGC

Reverse complement sequence

GCTGATTGTTGTAGATCCTCACGTACTCTCTCCGTCCTGAAATAAATATATTTTTGATATGTTTATGTGTTAAGTTTTAACCGTTAGTCTTATTTGAAAA[T/A]
TTTTTATGATTAGTATTTTTGTTGTTATTAGATGATAAAATATGAATAGTATTTTATGTGTGACTAATTTTTTTATTTTTTATTTATAAATTTTTCAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 44.30% 1.06% 0.68% NA
All Indica  2759 88.80% 8.30% 1.78% 1.16% NA
All Japonica  1512 0.20% 99.80% 0.00% 0.00% NA
Aus  269 22.70% 77.30% 0.00% 0.00% NA
Indica I  595 85.40% 11.80% 2.86% 0.00% NA
Indica II  465 87.30% 7.10% 2.15% 3.44% NA
Indica III  913 94.00% 4.40% 0.77% 0.88% NA
Indica Intermediate  786 86.30% 10.80% 1.91% 1.02% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 31.10% 67.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920282336 A -> DEL N N silent_mutation Average:34.347; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0920282336 A -> T LOC_Os09g34340-LOC_Os09g34847 intergenic_region ; MODIFIER silent_mutation Average:34.347; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920282336 NA 4.52E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 5.15E-07 7.93E-09 mr1103 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 5.93E-06 NA mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 8.92E-06 1.31E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 NA 1.57E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 5.05E-06 1.92E-08 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 NA 6.88E-09 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 NA 3.77E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 NA 4.21E-08 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 3.13E-06 7.00E-06 mr1437 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 NA 9.29E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 3.71E-06 5.09E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 NA 3.43E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 8.40E-06 NA mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 NA 1.73E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920282336 NA 1.81E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251