\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920162123:

Variant ID: vg0920162123 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20162123
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCAAACGTCTTATAAGATAAGGTCATCCTCAATGTTTGTTGCAAAAGTAGATAATAAGGTGAGTCCATGTAAGATGACAATAGTAGATTGAAGATGTA[T/C,G]
CATAATGTATATATATATAGAGTGGGTAATAAGGTAAAACCCATCTAAAAAAACCTCAAATATAAACTATGCCACAATTAAAAAATAGTTAGAACCCACC

Reverse complement sequence

GGTGGGTTCTAACTATTTTTTAATTGTGGCATAGTTTATATTTGAGGTTTTTTTAGATGGGTTTTACCTTATTACCCACTCTATATATATATACATTATG[A/G,C]
TACATCTTCAATCTACTATTGTCATCTTACATGGACTCACCTTATTATCTACTTTTGCAACAAACATTGAGGATGACCTTATCTTATAAGACGTTTGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 32.40% 0.59% 0.70% G: 12.72%
All Indica  2759 85.50% 3.50% 0.87% 0.69% G: 9.46%
All Japonica  1512 9.40% 88.80% 0.07% 0.00% G: 1.72%
Aus  269 1.10% 0.40% 0.37% 5.20% G: 92.94%
Indica I  595 86.20% 4.20% 1.34% 0.17% G: 8.07%
Indica II  465 90.30% 5.60% 0.43% 0.43% G: 3.23%
Indica III  913 87.50% 0.70% 0.66% 0.88% G: 10.30%
Indica Intermediate  786 79.80% 5.00% 1.02% 1.02% G: 13.23%
Temperate Japonica  767 11.10% 88.90% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 96.40% 0.00% 0.00% G: 2.18%
Japonica Intermediate  241 20.70% 72.60% 0.41% 0.00% G: 6.22%
VI/Aromatic  96 8.30% 41.70% 1.04% 0.00% G: 48.96%
Intermediate  90 24.40% 55.60% 1.11% 0.00% G: 18.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920162123 T -> G LOC_Os09g34150.1 upstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> G LOC_Os09g34150.2 upstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> G LOC_Os09g34140.1 downstream_gene_variant ; 4799.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> G LOC_Os09g34160.1 downstream_gene_variant ; 547.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> G LOC_Os09g34140.2 downstream_gene_variant ; 3867.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> G LOC_Os09g34150-LOC_Os09g34160 intergenic_region ; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> DEL N N silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> C LOC_Os09g34150.1 upstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> C LOC_Os09g34150.2 upstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> C LOC_Os09g34140.1 downstream_gene_variant ; 4799.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> C LOC_Os09g34160.1 downstream_gene_variant ; 547.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> C LOC_Os09g34140.2 downstream_gene_variant ; 3867.0bp to feature; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N
vg0920162123 T -> C LOC_Os09g34150-LOC_Os09g34160 intergenic_region ; MODIFIER silent_mutation Average:94.099; most accessible tissue: Zhenshan97 flag leaf, score: 98.192 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920162123 T C 0.01 0.02 0.02 0.02 0.02 0.01
vg0920162123 T G 0.03 0.02 0.03 0.03 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920162123 NA 2.03E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 7.33E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 3.90E-08 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 3.81E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 7.11E-20 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 2.22E-12 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 1.22E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 7.33E-30 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 6.84E-16 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 3.82E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 1.91E-07 3.23E-28 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 1.70E-11 5.71E-15 mr1518 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 8.88E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 1.19E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 2.90E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 7.17E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 7.90E-07 1.29E-31 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 4.27E-13 9.03E-18 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 8.07E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 8.03E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 2.06E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 3.06E-28 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 4.91E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 3.03E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 1.32E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 8.29E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 7.87E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 1.95E-20 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 1.37E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 7.52E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 2.02E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 3.34E-10 2.02E-33 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 1.26E-20 2.03E-24 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 2.59E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 1.37E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 1.57E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920162123 NA 5.09E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251