\
| Variant ID: vg0920135790 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 20135790 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.37, others allele: 0.00, population size: 86. )
GCCTTGTTTAGATCCTCCAAAATAGCAGCAAAAGTTTTGCTATTTTATAGCACTTTTTGCCATTTTGGATCTAAACACTAGTAGTAAAAGTTGGCAATTT[A/G]
GCATTTGCTAATCCATAGTAGCAAATTGTGCCAAAAAAGTGCTTTAGTACCACTCCCTCTCTCTTTCTCTCTCTCACTTTAGTGCTAGAATGGCAAAACT
AGTTTTGCCATTCTAGCACTAAAGTGAGAGAGAGAAAGAGAGAGGGAGTGGTACTAAAGCACTTTTTTGGCACAATTTGCTACTATGGATTAGCAAATGC[T/C]
AAATTGCCAACTTTTACTACTAGTGTTTAGATCCAAAATGGCAAAAAGTGCTATAAAATAGCAAAACTTTTGCTGCTATTTTGGAGGATCTAAACAAGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.00% | 38.60% | 1.84% | 2.54% | NA |
| All Indica | 2759 | 89.00% | 4.40% | 2.54% | 4.02% | NA |
| All Japonica | 1512 | 0.50% | 99.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 71.00% | 20.40% | 5.58% | 2.97% | NA |
| Indica I | 595 | 90.60% | 4.50% | 3.36% | 1.51% | NA |
| Indica II | 465 | 90.50% | 5.60% | 1.94% | 1.94% | NA |
| Indica III | 913 | 90.60% | 1.20% | 1.64% | 6.57% | NA |
| Indica Intermediate | 786 | 85.10% | 7.40% | 3.31% | 4.20% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.20% | 99.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 87.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 65.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0920135790 | A -> G | LOC_Os09g34110.1 | upstream_gene_variant ; 1432.0bp to feature; MODIFIER | silent_mutation | Average:44.856; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0920135790 | A -> G | LOC_Os09g34110.2 | upstream_gene_variant ; 1339.0bp to feature; MODIFIER | silent_mutation | Average:44.856; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0920135790 | A -> G | LOC_Os09g34110-LOC_Os09g34120 | intergenic_region ; MODIFIER | silent_mutation | Average:44.856; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0920135790 | A -> DEL | N | N | silent_mutation | Average:44.856; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0920135790 | 1.91E-08 | NA | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 1.78E-09 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 5.31E-16 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 3.91E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 2.55E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 3.03E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 8.24E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 1.02E-20 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | 3.78E-06 | 5.33E-10 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 3.42E-11 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 5.37E-09 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 1.34E-21 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | 4.82E-07 | 3.71E-12 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 1.25E-06 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 9.27E-58 | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 4.22E-06 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | 1.64E-06 | NA | mr1216_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 1.00E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | 4.48E-06 | 2.37E-24 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | 1.06E-10 | 3.77E-16 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0920135790 | NA | 6.71E-07 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |