Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920039290:

Variant ID: vg0920039290 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20039290
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CATCCTCCCAAATCCTAGATGAAACAGAAACAACCCATTCACCTTATATACTCCATCCTCCCAAATCCAAAATTAAACAAAAAAAACAAGGCGCTCTGCC[A/G]
CTGTGTCAAACTCTCCATCTACTACTTACTTCCTCCGTTTCACAATGTAAGTCATTTTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGCTAT

Reverse complement sequence

ATAGCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAAAATGACTTACATTGTGAAACGGAGGAAGTAAGTAGTAGATGGAGAGTTTGACACAG[T/C]
GGCAGAGCGCCTTGTTTTTTTTGTTTAATTTTGGATTTGGGAGGATGGAGTATATAAGGTGAATGGGTTGTTTCTGTTTCATCTAGGATTTGGGAGGATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	47.90%	0.11%	0.00%	NA
All Indica	2759	85.10%	14.80%	0.11%	0.00%	NA
All Japonica	1512	0.50%	99.50%	0.00%	0.00%	NA
Aus	269	20.10%	79.60%	0.37%	0.00%	NA
Indica I	595	88.90%	10.80%	0.34%	0.00%	NA
Indica II	465	86.00%	14.00%	0.00%	0.00%	NA
Indica III	913	88.30%	11.60%	0.11%	0.00%	NA
Indica Intermediate	786	78.10%	21.90%	0.00%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	24.40%	74.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920039290	A -> G	LOC_Os09g33940.1	downstream_gene_variant ; 1651.0bp to feature; MODIFIER	silent_mutation	Average:59.728; most accessible tissue: Callus, score: 81.869	N	N	N	N
vg0920039290	A -> G	LOC_Os09g33950.1	downstream_gene_variant ; 175.0bp to feature; MODIFIER	silent_mutation	Average:59.728; most accessible tissue: Callus, score: 81.869	N	N	N	N
vg0920039290	A -> G	LOC_Os09g33940.2	downstream_gene_variant ; 1650.0bp to feature; MODIFIER	silent_mutation	Average:59.728; most accessible tissue: Callus, score: 81.869	N	N	N	N
vg0920039290	A -> G	LOC_Os09g33940-LOC_Os09g33950	intergenic_region ; MODIFIER	silent_mutation	Average:59.728; most accessible tissue: Callus, score: 81.869	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920039290	NA	1.58E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	6.59E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	3.38E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	1.27E-25	4.84E-19	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	2.74E-22	8.77E-33	mr1216	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	1.84E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	1.39E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	1.78E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	3.14E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	1.51E-29	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	2.59E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	4.93E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	2.57E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	6.18E-07	NA	mr1216_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	5.87E-06	3.69E-48	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290	NA	4.70E-07	mr1793_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251