\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920039290:

Variant ID: vg0920039290 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20039290
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CATCCTCCCAAATCCTAGATGAAACAGAAACAACCCATTCACCTTATATACTCCATCCTCCCAAATCCAAAATTAAACAAAAAAAACAAGGCGCTCTGCC[A/G]
CTGTGTCAAACTCTCCATCTACTACTTACTTCCTCCGTTTCACAATGTAAGTCATTTTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGCTAT

Reverse complement sequence

ATAGCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAAAATGACTTACATTGTGAAACGGAGGAAGTAAGTAGTAGATGGAGAGTTTGACACAG[T/C]
GGCAGAGCGCCTTGTTTTTTTTGTTTAATTTTGGATTTGGGAGGATGGAGTATATAAGGTGAATGGGTTGTTTCTGTTTCATCTAGGATTTGGGAGGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 47.90% 0.11% 0.00% NA
All Indica  2759 85.10% 14.80% 0.11% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 20.10% 79.60% 0.37% 0.00% NA
Indica I  595 88.90% 10.80% 0.34% 0.00% NA
Indica II  465 86.00% 14.00% 0.00% 0.00% NA
Indica III  913 88.30% 11.60% 0.11% 0.00% NA
Indica Intermediate  786 78.10% 21.90% 0.00% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 24.40% 74.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920039290 A -> G LOC_Os09g33940.1 downstream_gene_variant ; 1651.0bp to feature; MODIFIER silent_mutation Average:59.728; most accessible tissue: Callus, score: 81.869 N N N N
vg0920039290 A -> G LOC_Os09g33950.1 downstream_gene_variant ; 175.0bp to feature; MODIFIER silent_mutation Average:59.728; most accessible tissue: Callus, score: 81.869 N N N N
vg0920039290 A -> G LOC_Os09g33940.2 downstream_gene_variant ; 1650.0bp to feature; MODIFIER silent_mutation Average:59.728; most accessible tissue: Callus, score: 81.869 N N N N
vg0920039290 A -> G LOC_Os09g33940-LOC_Os09g33950 intergenic_region ; MODIFIER silent_mutation Average:59.728; most accessible tissue: Callus, score: 81.869 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920039290 NA 1.58E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 6.59E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 3.38E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 1.27E-25 4.84E-19 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 2.74E-22 8.77E-33 mr1216 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 1.84E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 1.39E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 1.78E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 3.14E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 1.51E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 2.59E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 4.93E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 2.57E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 6.18E-07 NA mr1216_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 5.87E-06 3.69E-48 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920039290 NA 4.70E-07 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251