\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920014915:

Variant ID: vg0920014915 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20014915
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.21, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTTTTCATAATCACAATTTCTCTTATCTGCAACATTGTCTCACTGATTTTTTTTTCTTGCCTTGTACTCCCTCCGTTTCATAATGTAAGACTTTCTA[G/A]
CATTGCCCATATTCATATAGATGTTAATGAATATAGACACATATATATGTCTAGATTCATTAAAATCTATATGAATATGAGTAATGCTAGAAAGTCTTAC

Reverse complement sequence

GTAAGACTTTCTAGCATTACTCATATTCATATAGATTTTAATGAATCTAGACATATATATGTGTCTATATTCATTAACATCTATATGAATATGGGCAATG[C/T]
TAGAAAGTCTTACATTATGAAACGGAGGGAGTACAAGGCAAGAAAAAAAAATCAGTGAGACAATGTTGCAGATAAGAGAAATTGTGATTATGAAAACATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 39.70% 0.04% 0.30% NA
All Indica  2759 94.30% 5.40% 0.00% 0.29% NA
All Japonica  1512 0.30% 99.60% 0.00% 0.13% NA
Aus  269 72.90% 27.10% 0.00% 0.00% NA
Indica I  595 96.30% 3.20% 0.00% 0.50% NA
Indica II  465 93.50% 6.00% 0.00% 0.43% NA
Indica III  913 97.00% 2.80% 0.00% 0.11% NA
Indica Intermediate  786 89.90% 9.80% 0.00% 0.25% NA
Temperate Japonica  767 0.10% 99.70% 0.00% 0.13% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.80% 0.00% 0.41% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 32.20% 62.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920014915 G -> DEL N N silent_mutation Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0920014915 G -> A LOC_Os09g33890.1 upstream_gene_variant ; 4116.0bp to feature; MODIFIER silent_mutation Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0920014915 G -> A LOC_Os09g33920.1 upstream_gene_variant ; 4526.0bp to feature; MODIFIER silent_mutation Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0920014915 G -> A LOC_Os09g33920.2 upstream_gene_variant ; 4526.0bp to feature; MODIFIER silent_mutation Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0920014915 G -> A LOC_Os09g33910.1 downstream_gene_variant ; 656.0bp to feature; MODIFIER silent_mutation Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0920014915 G -> A LOC_Os09g33900.1 intron_variant ; MODIFIER silent_mutation Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0920014915 G -> A LOC_Os09g33900.2 intron_variant ; MODIFIER silent_mutation Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920014915 NA 8.24E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 7.87E-07 3.09E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 1.29E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 1.00E-07 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 1.72E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 1.05E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 1.86E-07 2.70E-09 mr1410 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 9.83E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 8.58E-20 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 4.38E-06 8.89E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 5.53E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 2.08E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 6.42E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 8.31E-22 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 7.04E-07 7.88E-09 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 9.66E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 3.86E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 7.56E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 3.89E-23 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 2.62E-06 5.80E-10 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915 NA 7.96E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251