Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920014915:

Variant ID: vg0920014915 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20014915
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.21, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TATGTTTTCATAATCACAATTTCTCTTATCTGCAACATTGTCTCACTGATTTTTTTTTCTTGCCTTGTACTCCCTCCGTTTCATAATGTAAGACTTTCTA[G/A]
CATTGCCCATATTCATATAGATGTTAATGAATATAGACACATATATATGTCTAGATTCATTAAAATCTATATGAATATGAGTAATGCTAGAAAGTCTTAC

Reverse complement sequence

GTAAGACTTTCTAGCATTACTCATATTCATATAGATTTTAATGAATCTAGACATATATATGTGTCTATATTCATTAACATCTATATGAATATGGGCAATG[C/T]
TAGAAAGTCTTACATTATGAAACGGAGGGAGTACAAGGCAAGAAAAAAAAATCAGTGAGACAATGTTGCAGATAAGAGAAATTGTGATTATGAAAACATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	39.70%	0.04%	0.30%	NA
All Indica	2759	94.30%	5.40%	0.00%	0.29%	NA
All Japonica	1512	0.30%	99.60%	0.00%	0.13%	NA
Aus	269	72.90%	27.10%	0.00%	0.00%	NA
Indica I	595	96.30%	3.20%	0.00%	0.50%	NA
Indica II	465	93.50%	6.00%	0.00%	0.43%	NA
Indica III	913	97.00%	2.80%	0.00%	0.11%	NA
Indica Intermediate	786	89.90%	9.80%	0.00%	0.25%	NA
Temperate Japonica	767	0.10%	99.70%	0.00%	0.13%	NA
Tropical Japonica	504	0.20%	99.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	98.80%	0.00%	0.41%	NA
VI/Aromatic	96	3.10%	95.80%	1.04%	0.00%	NA
Intermediate	90	32.20%	62.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920014915	G -> DEL	N	N	silent_mutation	Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499	N	N	N	N
vg0920014915	G -> A	LOC_Os09g33890.1	upstream_gene_variant ; 4116.0bp to feature; MODIFIER	silent_mutation	Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499	N	N	N	N
vg0920014915	G -> A	LOC_Os09g33920.1	upstream_gene_variant ; 4526.0bp to feature; MODIFIER	silent_mutation	Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499	N	N	N	N
vg0920014915	G -> A	LOC_Os09g33920.2	upstream_gene_variant ; 4526.0bp to feature; MODIFIER	silent_mutation	Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499	N	N	N	N
vg0920014915	G -> A	LOC_Os09g33910.1	downstream_gene_variant ; 656.0bp to feature; MODIFIER	silent_mutation	Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499	N	N	N	N
vg0920014915	G -> A	LOC_Os09g33900.1	intron_variant ; MODIFIER	silent_mutation	Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499	N	N	N	N
vg0920014915	G -> A	LOC_Os09g33900.2	intron_variant ; MODIFIER	silent_mutation	Average:32.423; most accessible tissue: Zhenshan97 young leaf, score: 38.499	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920014915	NA	8.24E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	7.87E-07	3.09E-07	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	1.29E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	1.00E-07	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	1.72E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	1.05E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	1.86E-07	2.70E-09	mr1410	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	9.83E-15	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	8.58E-20	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	4.38E-06	8.89E-08	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	5.53E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	2.08E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	6.42E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	8.31E-22	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	7.04E-07	7.88E-09	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	9.66E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	3.86E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	7.56E-10	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	3.89E-23	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	2.62E-06	5.80E-10	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920014915	NA	7.96E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251