| Variant ID: vg0919933719 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19933719 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 100. )
TTATGTTACATGTTGTCACTAGATCACCCTACACTGTTTATGCCATGATTATTGTCTTAACATTTTGGATTAAAATATGCCGATTTATTACCATATTTCC[G/A]
ACAATCCAAAAACCTGATAGGTCATTTTCGGTAGTTGGCTTTGCTGCTGCACTAAAACCACATGCTTTTGATGGTTCTAACTATAAGAGATGGAAAGCAC
GTGCTTTCCATCTCTTATAGTTAGAACCATCAAAAGCATGTGGTTTTAGTGCAGCAGCAAAGCCAACTACCGAAAATGACCTATCAGGTTTTTGGATTGT[C/T]
GGAAATATGGTAATAAATCGGCATATTTTAATCCAAAATGTTAAGACAATAATCATGGCATAAACAGTGTAGGGTGATCTAGTGACAACATGTAACATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.60% | 16.80% | 17.71% | 41.81% | NA |
| All Indica | 2759 | 3.20% | 4.90% | 25.95% | 66.00% | NA |
| All Japonica | 1512 | 62.60% | 35.40% | 1.72% | 0.20% | NA |
| Aus | 269 | 1.50% | 27.10% | 21.93% | 49.44% | NA |
| Indica I | 595 | 3.50% | 8.10% | 4.71% | 83.70% | NA |
| Indica II | 465 | 6.20% | 1.30% | 43.66% | 48.82% | NA |
| Indica III | 913 | 1.00% | 2.20% | 31.76% | 65.06% | NA |
| Indica Intermediate | 786 | 3.60% | 7.80% | 24.81% | 63.87% | NA |
| Temperate Japonica | 767 | 75.90% | 22.60% | 1.43% | 0.13% | NA |
| Tropical Japonica | 504 | 39.10% | 59.30% | 1.39% | 0.20% | NA |
| Japonica Intermediate | 241 | 69.70% | 26.60% | 3.32% | 0.41% | NA |
| VI/Aromatic | 96 | 43.80% | 30.20% | 20.83% | 5.21% | NA |
| Intermediate | 90 | 41.10% | 25.60% | 17.78% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919933719 | G -> DEL | N | N | silent_mutation | Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| vg0919933719 | G -> A | LOC_Os09g33740.1 | downstream_gene_variant ; 2006.0bp to feature; MODIFIER | silent_mutation | Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| vg0919933719 | G -> A | LOC_Os09g33750.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919933719 | NA | 2.02E-08 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919933719 | NA | 6.09E-08 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919933719 | NA | 5.59E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919933719 | NA | 5.11E-11 | mr1399_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919933719 | NA | 1.80E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919933719 | NA | 5.51E-06 | mr1667_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919933719 | NA | 1.03E-10 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |