\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919933719:

Variant ID: vg0919933719 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19933719
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGTTACATGTTGTCACTAGATCACCCTACACTGTTTATGCCATGATTATTGTCTTAACATTTTGGATTAAAATATGCCGATTTATTACCATATTTCC[G/A]
ACAATCCAAAAACCTGATAGGTCATTTTCGGTAGTTGGCTTTGCTGCTGCACTAAAACCACATGCTTTTGATGGTTCTAACTATAAGAGATGGAAAGCAC

Reverse complement sequence

GTGCTTTCCATCTCTTATAGTTAGAACCATCAAAAGCATGTGGTTTTAGTGCAGCAGCAAAGCCAACTACCGAAAATGACCTATCAGGTTTTTGGATTGT[C/T]
GGAAATATGGTAATAAATCGGCATATTTTAATCCAAAATGTTAAGACAATAATCATGGCATAAACAGTGTAGGGTGATCTAGTGACAACATGTAACATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.60% 16.80% 17.71% 41.81% NA
All Indica  2759 3.20% 4.90% 25.95% 66.00% NA
All Japonica  1512 62.60% 35.40% 1.72% 0.20% NA
Aus  269 1.50% 27.10% 21.93% 49.44% NA
Indica I  595 3.50% 8.10% 4.71% 83.70% NA
Indica II  465 6.20% 1.30% 43.66% 48.82% NA
Indica III  913 1.00% 2.20% 31.76% 65.06% NA
Indica Intermediate  786 3.60% 7.80% 24.81% 63.87% NA
Temperate Japonica  767 75.90% 22.60% 1.43% 0.13% NA
Tropical Japonica  504 39.10% 59.30% 1.39% 0.20% NA
Japonica Intermediate  241 69.70% 26.60% 3.32% 0.41% NA
VI/Aromatic  96 43.80% 30.20% 20.83% 5.21% NA
Intermediate  90 41.10% 25.60% 17.78% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919933719 G -> DEL N N silent_mutation Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0919933719 G -> A LOC_Os09g33740.1 downstream_gene_variant ; 2006.0bp to feature; MODIFIER silent_mutation Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0919933719 G -> A LOC_Os09g33750.1 intron_variant ; MODIFIER silent_mutation Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919933719 NA 2.02E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719 NA 6.09E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719 NA 5.59E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719 NA 5.11E-11 mr1399_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719 NA 1.80E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719 NA 5.51E-06 mr1667_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719 NA 1.03E-10 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251