Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0919933719:

Variant ID: vg0919933719 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19933719
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TTATGTTACATGTTGTCACTAGATCACCCTACACTGTTTATGCCATGATTATTGTCTTAACATTTTGGATTAAAATATGCCGATTTATTACCATATTTCC[G/A]
ACAATCCAAAAACCTGATAGGTCATTTTCGGTAGTTGGCTTTGCTGCTGCACTAAAACCACATGCTTTTGATGGTTCTAACTATAAGAGATGGAAAGCAC

Reverse complement sequence

GTGCTTTCCATCTCTTATAGTTAGAACCATCAAAAGCATGTGGTTTTAGTGCAGCAGCAAAGCCAACTACCGAAAATGACCTATCAGGTTTTTGGATTGT[C/T]
GGAAATATGGTAATAAATCGGCATATTTTAATCCAAAATGTTAAGACAATAATCATGGCATAAACAGTGTAGGGTGATCTAGTGACAACATGTAACATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.60%	16.80%	17.71%	41.81%	NA
All Indica	2759	3.20%	4.90%	25.95%	66.00%	NA
All Japonica	1512	62.60%	35.40%	1.72%	0.20%	NA
Aus	269	1.50%	27.10%	21.93%	49.44%	NA
Indica I	595	3.50%	8.10%	4.71%	83.70%	NA
Indica II	465	6.20%	1.30%	43.66%	48.82%	NA
Indica III	913	1.00%	2.20%	31.76%	65.06%	NA
Indica Intermediate	786	3.60%	7.80%	24.81%	63.87%	NA
Temperate Japonica	767	75.90%	22.60%	1.43%	0.13%	NA
Tropical Japonica	504	39.10%	59.30%	1.39%	0.20%	NA
Japonica Intermediate	241	69.70%	26.60%	3.32%	0.41%	NA
VI/Aromatic	96	43.80%	30.20%	20.83%	5.21%	NA
Intermediate	90	41.10%	25.60%	17.78%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919933719	G -> DEL	N	N	silent_mutation	Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0919933719	G -> A	LOC_Os09g33740.1	downstream_gene_variant ; 2006.0bp to feature; MODIFIER	silent_mutation	Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0919933719	G -> A	LOC_Os09g33750.1	intron_variant ; MODIFIER	silent_mutation	Average:21.629; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919933719	NA	2.02E-08	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719	NA	6.09E-08	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719	NA	5.59E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719	NA	5.11E-11	mr1399_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719	NA	1.80E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719	NA	5.51E-06	mr1667_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919933719	NA	1.03E-10	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251