\
| Variant ID: vg0919909996 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19909996 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 112. )
TTAAAAACCAAAAGAAGTTATTAATATCTTTAATACCAAATAAATGTACCATCACGACATATTTTAATGTGGATTTTAATAAAATTAATTTGATGTTATA[A/G]
ATATTGGCATATTTTTCTGTTTTAGTTATGTTTAAAGAAGTTTGTCTTAGAAAAAAACTAAAATGTCTTACAATATGAAATGGTGGGAGTACTCCCTTCA
TGAAGGGAGTACTCCCACCATTTCATATTGTAAGACATTTTAGTTTTTTTCTAAGACAAACTTCTTTAAACATAACTAAAACAGAAAAATATGCCAATAT[T/C]
TATAACATCAAATTAATTTTATTAAAATCCACATTAAAATATGTCGTGATGGTACATTTATTTGGTATTAAAGATATTAATAACTTCTTTTGGTTTTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 49.60% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 84.30% | 15.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 10.80% | 89.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.40% | 13.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.60% | 14.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 88.50% | 11.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 77.00% | 22.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 18.90% | 81.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919909996 | A -> G | LOC_Os09g33700.1 | upstream_gene_variant ; 1953.0bp to feature; MODIFIER | silent_mutation | Average:30.834; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0919909996 | A -> G | LOC_Os09g33710.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.834; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919909996 | NA | 3.95E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 2.62E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 8.92E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 3.89E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 5.23E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 8.80E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | 2.61E-27 | 9.28E-21 | mr1216 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | 2.59E-21 | 1.34E-32 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 1.38E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 6.03E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 2.15E-31 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 5.84E-08 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 2.39E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 1.30E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 5.19E-07 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | NA | 2.37E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | 9.50E-11 | 6.09E-59 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919909996 | 1.95E-09 | 3.05E-13 | mr1793_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |