\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919896432:

Variant ID: vg0919896432 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19896432
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.05, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGTGAAGTTGGTCCGAAGCCCGGAAGCGGCACCGAAGACAGAGAGGATGCCTTGGATGAACTCAAGGTCTTGCCGAACGGGGGAAAGGAAGAGAACT[A/G]
GATCATCGGCGTAGAGGGATGCACGATGTTGAATAGCACGATCATTGAGGGGAAGAAAACTACCCGAGTCAGAGGCTTTGCGGAGCATCGCATTGAGCAC

Reverse complement sequence

GTGCTCAATGCGATGCTCCGCAAAGCCTCTGACTCGGGTAGTTTTCTTCCCCTCAATGATCGTGCTATTCAACATCGTGCATCCCTCTACGCCGATGATC[T/C]
AGTTCTCTTCCTTTCCCCCGTTCGGCAAGACCTTGAGTTCATCCAAGGCATCCTCTCTGTCTTCGGTGCCGCTTCCGGGCTTCGGACCAACTTCACCAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 48.00% 0.49% 0.00% NA
All Indica  2759 84.40% 14.80% 0.83% 0.00% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 29.70% 70.30% 0.00% 0.00% NA
Indica I  595 91.90% 6.70% 1.34% 0.00% NA
Indica II  465 83.40% 15.90% 0.65% 0.00% NA
Indica III  913 87.10% 12.30% 0.66% 0.00% NA
Indica Intermediate  786 76.10% 23.20% 0.76% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 20.00% 80.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919896432 A -> G LOC_Os09g33690.1 downstream_gene_variant ; 4072.0bp to feature; MODIFIER silent_mutation Average:42.366; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0919896432 A -> G LOC_Os09g33690.3 downstream_gene_variant ; 4072.0bp to feature; MODIFIER silent_mutation Average:42.366; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0919896432 A -> G LOC_Os09g33690.2 downstream_gene_variant ; 4072.0bp to feature; MODIFIER silent_mutation Average:42.366; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0919896432 A -> G LOC_Os09g33690.4 downstream_gene_variant ; 4072.0bp to feature; MODIFIER silent_mutation Average:42.366; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0919896432 A -> G LOC_Os09g33680-LOC_Os09g33690 intergenic_region ; MODIFIER silent_mutation Average:42.366; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919896432 2.95E-08 3.36E-11 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919896432 4.45E-06 2.24E-11 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919896432 NA 2.20E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919896432 NA 8.66E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919896432 2.46E-06 NA mr1900_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251