\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919848647:

Variant ID: vg0919848647 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19848647
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAAGCAGTAAATGGGGCACTAACTACGCTCTGCCGGGGTGCAGCTAGAGGCGTAGCCTCATGGGCAGCGGACGCCTGGCCGGCCATCTGGCGCGCGGG[C/T]
GACGGCGGCGACTCGACGACCTCGTCATCGTCGCTGAAATCCCAGTCGACCTTCTCCTGGCTACCCGAAGAGGAGCCAGAGGAACACTGAGCGGATGTGG

Reverse complement sequence

CCACATCCGCTCAGTGTTCCTCTGGCTCCTCTTCGGGTAGCCAGGAGAAGGTCGACTGGGATTTCAGCGACGATGACGAGGTCGTCGAGTCGCCGCCGTC[G/A]
CCCGCGCGCCAGATGGCCGGCCAGGCGTCCGCTGCCCATGAGGCTACGCCTCTAGCTGCACCCCGGCAGAGCGTAGTTAGTGCCCCATTTACTGCTTCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 38.50% 0.19% 8.44% NA
All Indica  2759 86.30% 6.30% 0.29% 7.14% NA
All Japonica  1512 0.50% 99.20% 0.00% 0.26% NA
Aus  269 32.30% 0.70% 0.00% 66.91% NA
Indica I  595 96.50% 2.40% 0.34% 0.84% NA
Indica II  465 87.30% 5.80% 0.22% 6.67% NA
Indica III  913 85.80% 7.10% 0.00% 7.12% NA
Indica Intermediate  786 78.50% 8.70% 0.64% 12.21% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.40% 0.00% 0.20% NA
Japonica Intermediate  241 1.20% 97.50% 0.00% 1.24% NA
VI/Aromatic  96 3.10% 88.50% 0.00% 8.33% NA
Intermediate  90 22.20% 65.60% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919848647 C -> DEL N N silent_mutation Average:73.747; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0919848647 C -> T LOC_Os09g33610.1 intron_variant ; MODIFIER silent_mutation Average:73.747; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919848647 NA 7.19E-12 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 9.38E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 3.51E-11 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 4.69E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 5.13E-30 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 4.88E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 2.27E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 2.78E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 5.48E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 8.66E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 2.91E-09 8.60E-29 mr1518 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 2.72E-11 1.04E-18 mr1518 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 2.49E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 5.74E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 1.26E-07 7.93E-30 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 5.79E-09 8.31E-19 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 2.52E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 2.40E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 6.84E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 6.66E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 1.83E-18 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 1.25E-10 6.84E-35 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 1.28E-13 9.35E-27 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 1.27E-10 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919848647 NA 1.42E-10 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251