Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0919770032:

Variant ID: vg0919770032 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19770032
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.15, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GATGAGACCCCCGCGTGATTTTTTTTTTGTGGAGATGATCGGATCGAGCTCGCCCCCCTCAGATTGTAGAGATGGCAAACCGCGCGATTTGGCGGTTATT[G/T]
GGAGCCACGATTGTTGTTTTTTTGCGCCCGATTTCGTGATTTTGGTTCGCGATGGCCATTCGTTTGCGCTTTTCTGTTTTGTTTTGAGATGGTTGGGGGG

Reverse complement sequence

CCCCCCAACCATCTCAAAACAAAACAGAAAAGCGCAAACGAATGGCCATCGCGAACCAAAATCACGAAATCGGGCGCAAAAAAACAACAATCGTGGCTCC[C/A]
AATAACCGCCAAATCGCGCGGTTTGCCATCTCTACAATCTGAGGGGGGCGAGCTCGATCCGATCATCTCCACAAAAAAAAAATCACGCGGGGGTCTCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	46.00%	0.17%	0.00%	NA
All Indica	2759	23.60%	76.20%	0.22%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	84.00%	16.00%	0.00%	0.00%	NA
Indica I	595	45.40%	54.30%	0.34%	0.00%	NA
Indica II	465	16.30%	83.40%	0.22%	0.00%	NA
Indica III	913	10.80%	89.20%	0.00%	0.00%	NA
Indica Intermediate	786	26.30%	73.30%	0.38%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	23.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919770032	G -> T	LOC_Os09g33510.1	downstream_gene_variant ; 3567.0bp to feature; MODIFIER	silent_mutation	Average:75.13; most accessible tissue: Callus, score: 87.277	N	N	N	N
vg0919770032	G -> T	LOC_Os09g33510.2	downstream_gene_variant ; 4129.0bp to feature; MODIFIER	silent_mutation	Average:75.13; most accessible tissue: Callus, score: 87.277	N	N	N	N
vg0919770032	G -> T	LOC_Os09g33520.1	intron_variant ; MODIFIER	silent_mutation	Average:75.13; most accessible tissue: Callus, score: 87.277	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919770032	NA	3.42E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	2.80E-10	5.76E-13	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	2.30E-06	1.86E-09	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	NA	3.11E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	NA	5.51E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	NA	8.74E-09	mr1532	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	NA	2.93E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	NA	8.38E-14	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	NA	8.67E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919770032	NA	5.90E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251