\
| Variant ID: vg0919770032 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19770032 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.15, others allele: 0.00, population size: 100. )
GATGAGACCCCCGCGTGATTTTTTTTTTGTGGAGATGATCGGATCGAGCTCGCCCCCCTCAGATTGTAGAGATGGCAAACCGCGCGATTTGGCGGTTATT[G/T]
GGAGCCACGATTGTTGTTTTTTTGCGCCCGATTTCGTGATTTTGGTTCGCGATGGCCATTCGTTTGCGCTTTTCTGTTTTGTTTTGAGATGGTTGGGGGG
CCCCCCAACCATCTCAAAACAAAACAGAAAAGCGCAAACGAATGGCCATCGCGAACCAAAATCACGAAATCGGGCGCAAAAAAACAACAATCGTGGCTCC[C/A]
AATAACCGCCAAATCGCGCGGTTTGCCATCTCTACAATCTGAGGGGGGCGAGCTCGATCCGATCATCTCCACAAAAAAAAAATCACGCGGGGGTCTCATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 46.00% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 23.60% | 76.20% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 84.00% | 16.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.40% | 54.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 16.30% | 83.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 10.80% | 89.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 26.30% | 73.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 23.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919770032 | G -> T | LOC_Os09g33510.1 | downstream_gene_variant ; 3567.0bp to feature; MODIFIER | silent_mutation | Average:75.13; most accessible tissue: Callus, score: 87.277 | N | N | N | N |
| vg0919770032 | G -> T | LOC_Os09g33510.2 | downstream_gene_variant ; 4129.0bp to feature; MODIFIER | silent_mutation | Average:75.13; most accessible tissue: Callus, score: 87.277 | N | N | N | N |
| vg0919770032 | G -> T | LOC_Os09g33520.1 | intron_variant ; MODIFIER | silent_mutation | Average:75.13; most accessible tissue: Callus, score: 87.277 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919770032 | NA | 3.42E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | 2.80E-10 | 5.76E-13 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | 2.30E-06 | 1.86E-09 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | NA | 3.11E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | NA | 5.51E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | NA | 8.74E-09 | mr1532 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | NA | 2.93E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | NA | 8.38E-14 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | NA | 8.67E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919770032 | NA | 5.90E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |