\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919635520:

Variant ID: vg0919635520 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19635520
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGTGTTTTTAGCGATCTAAAAGCAAAGGCTGAAAAATAAACTTCAATGAAAAAACCCCAAAATCAACTCCAAATTTAAGGTTAAAAATTTAAATTTG[A/G]
CTGATAAGTATAAGTATAAGAGAAAAGATGATGCCCTTTGTTTTAGAATTATAAGCGAATTTATGAGTCAAAACGTTTAAGGGCCTCTTTATTGAGGCTT

Reverse complement sequence

AAGCCTCAATAAAGAGGCCCTTAAACGTTTTGACTCATAAATTCGCTTATAATTCTAAAACAAAGGGCATCATCTTTTCTCTTATACTTATACTTATCAG[T/C]
CAAATTTAAATTTTTAACCTTAAATTTGGAGTTGATTTTGGGGTTTTTTCATTGAAGTTTATTTTTCAGCCTTTGCTTTTAGATCGCTAAAAACACATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.70% 0.19% 0.00% NA
All Indica  2759 89.60% 10.20% 0.22% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 91.70% 8.20% 0.11% 0.00% NA
Indica Intermediate  786 83.60% 15.80% 0.64% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 1.04% 0.00% NA
Intermediate  90 36.70% 61.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919635520 A -> G LOC_Os09g32940.1 downstream_gene_variant ; 825.0bp to feature; MODIFIER silent_mutation Average:71.244; most accessible tissue: Minghui63 flower, score: 86.854 N N N N
vg0919635520 A -> G LOC_Os09g32940.3 downstream_gene_variant ; 825.0bp to feature; MODIFIER silent_mutation Average:71.244; most accessible tissue: Minghui63 flower, score: 86.854 N N N N
vg0919635520 A -> G LOC_Os09g32940.4 downstream_gene_variant ; 3383.0bp to feature; MODIFIER silent_mutation Average:71.244; most accessible tissue: Minghui63 flower, score: 86.854 N N N N
vg0919635520 A -> G LOC_Os09g32940.2 downstream_gene_variant ; 825.0bp to feature; MODIFIER silent_mutation Average:71.244; most accessible tissue: Minghui63 flower, score: 86.854 N N N N
vg0919635520 A -> G LOC_Os09g32940-LOC_Os09g32944 intergenic_region ; MODIFIER silent_mutation Average:71.244; most accessible tissue: Minghui63 flower, score: 86.854 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919635520 NA 5.23E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 7.13E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 2.22E-07 NA mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 7.36E-08 1.26E-14 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 5.75E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.85E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 3.69E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.64E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.33E-32 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 7.58E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 2.54E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 8.86E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.32E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 2.65E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 9.85E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 5.24E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.05E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.35E-28 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 7.76E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 4.71E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 6.65E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 5.98E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.33E-17 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 3.65E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.64E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 5.28E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 5.56E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 1.13E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 5.13E-08 mr1216_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 2.46E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 6.10E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 2.11E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 2.42E-17 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919635520 NA 7.04E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251