\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919632209:

Variant ID: vg0919632209 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 19632209
Reference Allele: CAlternative Allele: A,CA
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, C: 0.04, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTATCTTTTGGGTATCTTGTATCTTAGTTGTGGGGATGCTAAACGTATTTTTTTTAGTTTCAAATCTTAGTGCTAACAGTATCTCTTTTACCCCCC[C/A,CA]
AAAAAAAAGCCTTCTCTGTTAGCTTGCAGGTTCCAATTTCCTTAAAAGAAGCATAATTACCCACAACTCTTCTGATGCAAAGTTGCAAGCGTTGATATTG

Reverse complement sequence

CAATATCAACGCTTGCAACTTTGCATCAGAAGAGTTGTGGGTAATTATGCTTCTTTTAAGGAAATTGGAACCTGCAAGCTAACAGAGAAGGCTTTTTTTT[G/T,TG]
GGGGGGTAAAAGAGATACTGTTAGCACTAAGATTTGAAACTAAAAAAAATACGTTTAGCATCCCCACAACTAAGATACAAGATACCCAAAAGATAAAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 13.30% 1.12% 0.00% CA: 1.65%
All Indica  2759 95.40% 1.60% 1.05% 0.00% CA: 1.92%
All Japonica  1512 60.50% 36.70% 1.46% 0.00% CA: 1.32%
Aus  269 98.10% 0.40% 0.37% 0.00% CA: 1.12%
Indica I  595 94.60% 2.70% 1.68% 0.00% CA: 1.01%
Indica II  465 94.20% 1.50% 1.72% 0.00% CA: 2.58%
Indica III  913 97.50% 0.20% 0.00% 0.00% CA: 2.30%
Indica Intermediate  786 94.30% 2.50% 1.40% 0.00% CA: 1.78%
Temperate Japonica  767 35.90% 61.90% 1.69% 0.00% CA: 0.52%
Tropical Japonica  504 89.50% 7.30% 0.99% 0.00% CA: 2.18%
Japonica Intermediate  241 78.40% 17.80% 1.66% 0.00% CA: 2.07%
VI/Aromatic  96 97.90% 1.00% 0.00% 0.00% CA: 1.04%
Intermediate  90 70.00% 27.80% 1.11% 0.00% CA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919632209 C -> CA LOC_Os09g32930.1 downstream_gene_variant ; 3513.0bp to feature; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> CA LOC_Os09g32930.3 downstream_gene_variant ; 3517.0bp to feature; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> CA LOC_Os09g32940.4 downstream_gene_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> CA LOC_Os09g32940.1 intron_variant ; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> CA LOC_Os09g32940.3 intron_variant ; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> CA LOC_Os09g32940.2 intron_variant ; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> A LOC_Os09g32930.1 downstream_gene_variant ; 3512.0bp to feature; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> A LOC_Os09g32930.3 downstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> A LOC_Os09g32940.4 downstream_gene_variant ; 72.0bp to feature; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> A LOC_Os09g32940.1 intron_variant ; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> A LOC_Os09g32940.3 intron_variant ; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N
vg0919632209 C -> A LOC_Os09g32940.2 intron_variant ; MODIFIER silent_mutation Average:36.908; most accessible tissue: Callus, score: 82.018 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919632209 NA 4.86E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919632209 NA 8.34E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0919632209 NA 1.17E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 4.50E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 6.02E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 1.54E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 6.44E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 6.08E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 6.90E-06 mr1405 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 9.72E-06 9.72E-06 mr1418 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 2.47E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 1.63E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 2.67E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 6.88E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 5.62E-07 5.62E-07 mr1833 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 4.53E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 1.23E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 5.91E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 1.41E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 5.77E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919632209 NA 1.99E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251