\
| Variant ID: vg0919514800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19514800 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 112. )
ATTAGCTATAGAATAGGATTATATAAGTAGGAGGGAGGGATGATTAGAGGAAGGAAGAAACATATACGTACTATGTATATATGTACTTGCAATGTGGGCT[A/T]
GTGGGTGGGAGAGAGTATATGCACGTAACGTACGTACAGGTGTGACCATATGTACTTCTAATTTCTAATGTCTAGGTTGTTGTAAGATTAATTTAATCTA
TAGATTAAATTAATCTTACAACAACCTAGACATTAGAAATTAGAAGTACATATGGTCACACCTGTACGTACGTTACGTGCATATACTCTCTCCCACCCAC[T/A]
AGCCCACATTGCAAGTACATATATACATAGTACGTATATGTTTCTTCCTTCCTCTAATCATCCCTCCCTCCTACTTATATAATCCTATTCTATAGCTAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 36.90% | 12.95% | 0.36% | NA |
| All Indica | 2759 | 23.60% | 56.60% | 19.21% | 0.62% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 19.30% | 54.30% | 26.39% | 0.00% | NA |
| Indica I | 595 | 27.20% | 54.30% | 18.32% | 0.17% | NA |
| Indica II | 465 | 24.70% | 51.40% | 22.15% | 1.72% | NA |
| Indica III | 913 | 20.20% | 62.50% | 16.87% | 0.44% | NA |
| Indica Intermediate | 786 | 24.00% | 54.60% | 20.87% | 0.51% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 12.50% | 8.33% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 24.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919514800 | A -> DEL | N | N | silent_mutation | Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0919514800 | A -> T | LOC_Os09g32710.1 | upstream_gene_variant ; 2126.0bp to feature; MODIFIER | silent_mutation | Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0919514800 | A -> T | LOC_Os09g32730.1 | downstream_gene_variant ; 4440.0bp to feature; MODIFIER | silent_mutation | Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| vg0919514800 | A -> T | LOC_Os09g32710-LOC_Os09g32730 | intergenic_region ; MODIFIER | silent_mutation | Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919514800 | NA | 6.09E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | NA | 9.16E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | 7.79E-06 | 1.48E-07 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | NA | 1.39E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | NA | 4.14E-24 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | 1.61E-06 | 4.23E-07 | mr1548 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | NA | 4.05E-21 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | NA | 3.41E-08 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | NA | 8.79E-07 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | NA | 6.56E-21 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919514800 | NA | 8.73E-06 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |