\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919514800:

Variant ID: vg0919514800 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19514800
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGCTATAGAATAGGATTATATAAGTAGGAGGGAGGGATGATTAGAGGAAGGAAGAAACATATACGTACTATGTATATATGTACTTGCAATGTGGGCT[A/T]
GTGGGTGGGAGAGAGTATATGCACGTAACGTACGTACAGGTGTGACCATATGTACTTCTAATTTCTAATGTCTAGGTTGTTGTAAGATTAATTTAATCTA

Reverse complement sequence

TAGATTAAATTAATCTTACAACAACCTAGACATTAGAAATTAGAAGTACATATGGTCACACCTGTACGTACGTTACGTGCATATACTCTCTCCCACCCAC[T/A]
AGCCCACATTGCAAGTACATATATACATAGTACGTATATGTTTCTTCCTTCCTCTAATCATCCCTCCCTCCTACTTATATAATCCTATTCTATAGCTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 36.90% 12.95% 0.36% NA
All Indica  2759 23.60% 56.60% 19.21% 0.62% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 19.30% 54.30% 26.39% 0.00% NA
Indica I  595 27.20% 54.30% 18.32% 0.17% NA
Indica II  465 24.70% 51.40% 22.15% 1.72% NA
Indica III  913 20.20% 62.50% 16.87% 0.44% NA
Indica Intermediate  786 24.00% 54.60% 20.87% 0.51% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 12.50% 8.33% 0.00% NA
Intermediate  90 72.20% 24.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919514800 A -> DEL N N silent_mutation Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0919514800 A -> T LOC_Os09g32710.1 upstream_gene_variant ; 2126.0bp to feature; MODIFIER silent_mutation Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0919514800 A -> T LOC_Os09g32730.1 downstream_gene_variant ; 4440.0bp to feature; MODIFIER silent_mutation Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0919514800 A -> T LOC_Os09g32710-LOC_Os09g32730 intergenic_region ; MODIFIER silent_mutation Average:40.778; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919514800 NA 6.09E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 NA 9.16E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 7.79E-06 1.48E-07 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 NA 1.39E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 NA 4.14E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 1.61E-06 4.23E-07 mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 NA 4.05E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 NA 3.41E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 NA 8.79E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 NA 6.56E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919514800 NA 8.73E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251