Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0919230563:

Variant ID: vg0919230563 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 19230563
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.15, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTCACCGCTAGTTCCATCCTTCTCTCTCTCCCTCCTCTCCCATGTGTTGCGTGCGTGCCCCACTCCAACCACCTCGCACCGCCAAGCTCTCCACCCCC[T/C]
CTCTCTCTTTCTCCCCTTTCCCTTTTTATCTCTTAGTCACTAAGCTTTTCTTGGCTCCTTTGCTACCTTTGTTTTTCTCCTCCCTCTACTTTGTCCGTGG

Reverse complement sequence

CCACGGACAAAGTAGAGGGAGGAGAAAAACAAAGGTAGCAAAGGAGCCAAGAAAAGCTTAGTGACTAAGAGATAAAAAGGGAAAGGGGAGAAAGAGAGAG[A/G]
GGGGGTGGAGAGCTTGGCGGTGCGAGGTGGTTGGAGTGGGGCACGCACGCAACACATGGGAGAGGAGGGAGAGAGAGAAGGATGGAACTAGCGGTGAAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	35.20%	0.74%	0.00%	NA
All Indica	2759	51.50%	47.30%	1.23%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	7.10%	92.90%	0.00%	0.00%	NA
Indica I	595	25.90%	72.40%	1.68%	0.00%	NA
Indica II	465	72.70%	25.80%	1.51%	0.00%	NA
Indica III	913	57.30%	42.40%	0.33%	0.00%	NA
Indica Intermediate	786	51.50%	46.70%	1.78%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0919230563	T -> C	LOC_Os09g32210.1	upstream_gene_variant ; 2999.0bp to feature; MODIFIER	silent_mutation	Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg0919230563	T -> C	LOC_Os09g32220.1	upstream_gene_variant ; 4630.0bp to feature; MODIFIER	silent_mutation	Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg0919230563	T -> C	LOC_Os09g32210-LOC_Os09g32220	intergenic_region ; MODIFIER	silent_mutation	Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0919230563	NA	9.80E-12	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563	NA	1.89E-07	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563	3.73E-06	NA	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563	5.12E-08	1.43E-12	mr1557	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563	3.75E-06	8.04E-11	mr1598	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563	NA	7.28E-07	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563	3.71E-06	2.46E-11	mr1557_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563	5.78E-08	NA	mr1598_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563	8.89E-09	1.29E-15	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251