| Variant ID: vg0919230563 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 19230563 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.15, others allele: 0.00, population size: 99. )
CCTTCACCGCTAGTTCCATCCTTCTCTCTCTCCCTCCTCTCCCATGTGTTGCGTGCGTGCCCCACTCCAACCACCTCGCACCGCCAAGCTCTCCACCCCC[T/C]
CTCTCTCTTTCTCCCCTTTCCCTTTTTATCTCTTAGTCACTAAGCTTTTCTTGGCTCCTTTGCTACCTTTGTTTTTCTCCTCCCTCTACTTTGTCCGTGG
CCACGGACAAAGTAGAGGGAGGAGAAAAACAAAGGTAGCAAAGGAGCCAAGAAAAGCTTAGTGACTAAGAGATAAAAAGGGAAAGGGGAGAAAGAGAGAG[A/G]
GGGGGTGGAGAGCTTGGCGGTGCGAGGTGGTTGGAGTGGGGCACGCACGCAACACATGGGAGAGGAGGGAGAGAGAGAAGGATGGAACTAGCGGTGAAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 35.20% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 51.50% | 47.30% | 1.23% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 25.90% | 72.40% | 1.68% | 0.00% | NA |
| Indica II | 465 | 72.70% | 25.80% | 1.51% | 0.00% | NA |
| Indica III | 913 | 57.30% | 42.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 51.50% | 46.70% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0919230563 | T -> C | LOC_Os09g32210.1 | upstream_gene_variant ; 2999.0bp to feature; MODIFIER | silent_mutation | Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| vg0919230563 | T -> C | LOC_Os09g32220.1 | upstream_gene_variant ; 4630.0bp to feature; MODIFIER | silent_mutation | Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| vg0919230563 | T -> C | LOC_Os09g32210-LOC_Os09g32220 | intergenic_region ; MODIFIER | silent_mutation | Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0919230563 | NA | 9.80E-12 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919230563 | NA | 1.89E-07 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919230563 | 3.73E-06 | NA | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919230563 | 5.12E-08 | 1.43E-12 | mr1557 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919230563 | 3.75E-06 | 8.04E-11 | mr1598 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919230563 | NA | 7.28E-07 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919230563 | 3.71E-06 | 2.46E-11 | mr1557_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919230563 | 5.78E-08 | NA | mr1598_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0919230563 | 8.89E-09 | 1.29E-15 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |