\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919230563:

Variant ID: vg0919230563 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19230563
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.15, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTCACCGCTAGTTCCATCCTTCTCTCTCTCCCTCCTCTCCCATGTGTTGCGTGCGTGCCCCACTCCAACCACCTCGCACCGCCAAGCTCTCCACCCCC[T/C]
CTCTCTCTTTCTCCCCTTTCCCTTTTTATCTCTTAGTCACTAAGCTTTTCTTGGCTCCTTTGCTACCTTTGTTTTTCTCCTCCCTCTACTTTGTCCGTGG

Reverse complement sequence

CCACGGACAAAGTAGAGGGAGGAGAAAAACAAAGGTAGCAAAGGAGCCAAGAAAAGCTTAGTGACTAAGAGATAAAAAGGGAAAGGGGAGAAAGAGAGAG[A/G]
GGGGGTGGAGAGCTTGGCGGTGCGAGGTGGTTGGAGTGGGGCACGCACGCAACACATGGGAGAGGAGGGAGAGAGAGAAGGATGGAACTAGCGGTGAAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 35.20% 0.74% 0.00% NA
All Indica  2759 51.50% 47.30% 1.23% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 25.90% 72.40% 1.68% 0.00% NA
Indica II  465 72.70% 25.80% 1.51% 0.00% NA
Indica III  913 57.30% 42.40% 0.33% 0.00% NA
Indica Intermediate  786 51.50% 46.70% 1.78% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919230563 T -> C LOC_Os09g32210.1 upstream_gene_variant ; 2999.0bp to feature; MODIFIER silent_mutation Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg0919230563 T -> C LOC_Os09g32220.1 upstream_gene_variant ; 4630.0bp to feature; MODIFIER silent_mutation Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg0919230563 T -> C LOC_Os09g32210-LOC_Os09g32220 intergenic_region ; MODIFIER silent_mutation Average:65.196; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919230563 NA 9.80E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563 NA 1.89E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563 3.73E-06 NA mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563 5.12E-08 1.43E-12 mr1557 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563 3.75E-06 8.04E-11 mr1598 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563 NA 7.28E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563 3.71E-06 2.46E-11 mr1557_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563 5.78E-08 NA mr1598_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919230563 8.89E-09 1.29E-15 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251