Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0918940911:

Variant ID: vg0918940911 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18940911
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGCCACTATACGCAAACAATCGAAAACCTAAACAAAGGACCAAAAGAAAGATCCTATTTAGACTAATTAGTAGTGCCATTAAATAGATCTCAATTTCAC[G/A]
GAATTACTGGAAGTGAAACGGAGTCAATCGGACGAGCGGTTGGGGAGATATGAATTTTGGAAGTTTAATTGGAGTTTCTGGAATAGGAGAAATGGTTTAT

Reverse complement sequence

ATAAACCATTTCTCCTATTCCAGAAACTCCAATTAAACTTCCAAAATTCATATCTCCCCAACCGCTCGTCCGATTGACTCCGTTTCACTTCCAGTAATTC[C/T]
GTGAAATTGAGATCTATTTAATGGCACTACTAATTAGTCTAAATAGGATCTTTCTTTTGGTCCTTTGTTTAGGTTTTCGATTGTTTGCGTATAGTGGCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	3.30%	6.01%	51.80%	NA
All Indica	2759	7.90%	0.10%	8.34%	83.62%	NA
All Japonica	1512	89.20%	9.80%	1.06%	0.00%	NA
Aus	269	45.40%	0.40%	11.15%	43.12%	NA
Indica I	595	7.10%	0.00%	7.06%	85.88%	NA
Indica II	465	7.50%	0.20%	7.96%	84.30%	NA
Indica III	913	5.80%	0.10%	9.86%	84.23%	NA
Indica Intermediate	786	11.30%	0.10%	7.76%	80.79%	NA
Temperate Japonica	767	99.00%	0.10%	0.91%	0.00%	NA
Tropical Japonica	504	74.40%	24.80%	0.79%	0.00%	NA
Japonica Intermediate	241	88.80%	9.10%	2.07%	0.00%	NA
VI/Aromatic	96	95.80%	0.00%	1.04%	3.12%	NA
Intermediate	90	64.40%	3.30%	7.78%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918940911	G -> DEL	N	N	silent_mutation	Average:42.237; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N
vg0918940911	G -> A	LOC_Os09g31442.1	upstream_gene_variant ; 1932.0bp to feature; MODIFIER	silent_mutation	Average:42.237; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N
vg0918940911	G -> A	LOC_Os09g31446.1	downstream_gene_variant ; 3491.0bp to feature; MODIFIER	silent_mutation	Average:42.237; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N
vg0918940911	G -> A	LOC_Os09g31442-LOC_Os09g31446	intergenic_region ; MODIFIER	silent_mutation	Average:42.237; most accessible tissue: Zhenshan97 flag leaf, score: 90.467	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0918940911	G	A	0.01	0.01	0.01	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918940911	NA	1.78E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	4.86E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	6.36E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	1.73E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	5.23E-08	mr1225	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	2.13E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	4.57E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	7.14E-06	mr1636	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	7.02E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	2.21E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	1.48E-06	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918940911	NA	8.07E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251