\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918936020:

Variant ID: vg0918936020 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18936020
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GGATGTTTTGGAAGTCGTATGAACCGACATTTAAAAGAAAACCGCTAGCGAAAGCTAACTTGTAATGTAGTCATCGATAAAAGCTCTTATGTCCATGGTA[C/T]
GCACAATTTACCTATTTTCACTAGATCTGATTAAAACATTCTCTCCACAAACAACATCAAGAATGATATATCTGGTAGGGACTTTTCTCCTGTGTTAGAC

Reverse complement sequence

GTCTAACACAGGAGAAAAGTCCCTACCAGATATATCATTCTTGATGTTGTTTGTGGAGAGAATGTTTTAATCAGATCTAGTGAAAATAGGTAAATTGTGC[G/A]
TACCATGGACATAAGAGCTTTTATCGATGACTACATTACAAGTTAGCTTTCGCTAGCGGTTTTCTTTTAAATGTCGGTTCATACGACTTCCAAAACATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 23.00% 0.04% 0.42% NA
All Indica  2759 68.60% 30.60% 0.07% 0.72% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 17.80% 82.20% 0.00% 0.00% NA
Indica I  595 86.40% 13.40% 0.00% 0.17% NA
Indica II  465 29.20% 69.50% 0.00% 1.29% NA
Indica III  913 81.30% 17.70% 0.11% 0.88% NA
Indica Intermediate  786 63.90% 35.40% 0.13% 0.64% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918936020 C -> DEL N N silent_mutation Average:54.317; most accessible tissue: Callus, score: 86.458 N N N N
vg0918936020 C -> T LOC_Os09g31442.1 downstream_gene_variant ; 1353.0bp to feature; MODIFIER silent_mutation Average:54.317; most accessible tissue: Callus, score: 86.458 N N N N
vg0918936020 C -> T LOC_Os09g31438-LOC_Os09g31442 intergenic_region ; MODIFIER silent_mutation Average:54.317; most accessible tissue: Callus, score: 86.458 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918936020 8.89E-07 1.45E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 7.26E-07 8.08E-10 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 6.09E-08 1.51E-17 mr1232 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 4.93E-09 1.98E-09 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 7.15E-12 6.73E-35 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 1.03E-12 9.75E-19 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 1.20E-08 NA mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 3.11E-07 5.92E-12 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 NA 3.64E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 NA 4.02E-08 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 NA 2.37E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 NA 1.58E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 3.13E-07 1.26E-24 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 3.21E-08 1.28E-12 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 1.67E-08 NA mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 5.06E-08 1.03E-14 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 NA 7.50E-08 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918936020 NA 7.32E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251