\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918928440:

Variant ID: vg0918928440 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18928440
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCCTAATTAATCCATGATTAGCCTATGTGATACTACAGTAAACATTCTCTAATTATGGATTAATTAGGCTTAAAAAATTTGTCTCGTAAATTAGTTTT[C/T]
ATTTATATAATTAGTTTTGTAAGTAGTATATATTTAATACTCTAAATTAGTGTCTAAATAAAGAGACTAAAGTTAAGTCCCTGGATCCAAACACCACCAC

Reverse complement sequence

GTGGTGGTGTTTGGATCCAGGGACTTAACTTTAGTCTCTTTATTTAGACACTAATTTAGAGTATTAAATATATACTACTTACAAAACTAATTATATAAAT[G/A]
AAAACTAATTTACGAGACAAATTTTTTAAGCCTAATTAATCCATAATTAGAGAATGTTTACTGTAGTATCACATAGGCTAATCATGGATTAATTAGGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 15.70% 14.94% 19.30% NA
All Indica  2759 22.70% 21.40% 23.12% 32.80% NA
All Japonica  1512 91.30% 6.30% 2.31% 0.00% NA
Aus  269 77.00% 13.40% 9.29% 0.37% NA
Indica I  595 26.10% 11.90% 24.37% 37.65% NA
Indica II  465 21.30% 30.30% 24.52% 23.87% NA
Indica III  913 18.10% 24.90% 19.28% 37.79% NA
Indica Intermediate  786 26.30% 19.20% 25.83% 28.63% NA
Temperate Japonica  767 88.40% 7.30% 4.30% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 84.60% 14.90% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 7.30% 3.12% 0.00% NA
Intermediate  90 74.40% 13.30% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918928440 C -> DEL N N silent_mutation Average:44.202; most accessible tissue: Callus, score: 85.476 N N N N
vg0918928440 C -> T LOC_Os09g31438-LOC_Os09g31442 intergenic_region ; MODIFIER silent_mutation Average:44.202; most accessible tissue: Callus, score: 85.476 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918928440 NA 1.09E-11 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918928440 NA 1.38E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 7.71E-07 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 1.52E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 3.60E-08 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 2.73E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 1.37E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 3.59E-08 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 9.65E-06 9.64E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 6.85E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 3.92E-08 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 2.79E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 9.23E-07 9.23E-07 mr1795 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 4.49E-06 4.49E-06 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 7.68E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 7.16E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 3.99E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 2.00E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 NA 7.55E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918928440 5.01E-06 5.01E-06 mr1940_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251