\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918923624:

Variant ID: vg0918923624 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18923624
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAAAAATCATAATTTTATATCAACTTTCAAAAATAATTATTCTTAGAAAATTATCAAGAAAGTATAGAATTATGTCACCATAAAACAACGTGATAATC[C/T]
AAACAATGCTAGCATATAACCCATTAATCGAGAGTACTTGATAAATGTAGTGCTAGGTATACGTGGTTTGCTTCAAAGCACTAGAGATGTGTTAGTGGAT

Reverse complement sequence

ATCCACTAACACATCTCTAGTGCTTTGAAGCAAACCACGTATACCTAGCACTACATTTATCAAGTACTCTCGATTAATGGGTTATATGCTAGCATTGTTT[G/A]
GATTATCACGTTGTTTTATGGTGACATAATTCTATACTTTCTTGATAATTTTCTAAGAATAATTATTTTTGAAAGTTGATATAAAATTATGATTTTTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 40.00% 0.32% 0.00% NA
All Indica  2759 34.10% 65.30% 0.54% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 75.80% 24.20% 0.00% 0.00% NA
Indica I  595 16.80% 83.00% 0.17% 0.00% NA
Indica II  465 71.40% 27.70% 0.86% 0.00% NA
Indica III  913 20.30% 78.90% 0.88% 0.00% NA
Indica Intermediate  786 41.20% 58.50% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918923624 C -> T LOC_Os09g31438.1 upstream_gene_variant ; 1968.0bp to feature; MODIFIER silent_mutation Average:73.292; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0918923624 C -> T LOC_Os09g31438-LOC_Os09g31442 intergenic_region ; MODIFIER silent_mutation Average:73.292; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918923624 NA 1.04E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 8.70E-09 NA mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 3.81E-09 3.73E-13 mr1231 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 4.18E-10 NA mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 1.14E-10 2.04E-11 mr1232 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 3.24E-23 NA mr1557 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 1.06E-22 3.95E-33 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 1.17E-19 9.12E-42 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 7.46E-16 4.08E-23 mr1598 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 3.17E-09 NA mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 3.00E-10 5.04E-14 mr1944 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 NA 8.45E-11 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 NA 5.75E-08 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 NA 8.67E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 NA 2.19E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 NA 3.62E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 5.67E-14 NA mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 6.89E-15 6.23E-25 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 6.09E-16 3.20E-58 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 3.11E-15 7.52E-29 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918923624 NA 7.27E-16 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251