\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918906558:

Variant ID: vg0918906558 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18906558
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCTCATGGTGCCTGGGTAGTCACCATGCACGATAGGGTCCATGAACCACCCATAGATGAAGTCTAGGCTCCGTTGCACAGCGCCACGGTCAGCGTCGG[A/T]
GTTGTCGTACGGCACGAACCAGTGGGTGACCACCACCATGCCGATCTGTCCCTTCTGTGTTGGCTGGTACTTGGTGCGGTAAAGCTGGACAGCGGCAGCG

Reverse complement sequence

CGCTGCCGCTGTCCAGCTTTACCGCACCAAGTACCAGCCAACACAGAAGGGACAGATCGGCATGGTGGTGGTCACCCACTGGTTCGTGCCGTACGACAAC[T/A]
CCGACGCTGACCGTGGCGCTGTGCAACGGAGCCTAGACTTCATCTATGGGTGGTTCATGGACCCTATCGTGCATGGTGACTACCCAGGCACCATGAGAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 34.80% 0.44% 0.02% NA
All Indica  2759 95.90% 3.70% 0.36% 0.04% NA
All Japonica  1512 15.00% 84.50% 0.46% 0.00% NA
Aus  269 51.30% 48.30% 0.37% 0.00% NA
Indica I  595 97.60% 2.00% 0.34% 0.00% NA
Indica II  465 95.50% 4.10% 0.43% 0.00% NA
Indica III  913 96.60% 3.10% 0.33% 0.00% NA
Indica Intermediate  786 93.90% 5.60% 0.38% 0.13% NA
Temperate Japonica  767 19.20% 80.10% 0.78% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 29.00% 70.50% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 85.40% 1.04% 0.00% NA
Intermediate  90 40.00% 57.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918906558 A -> DEL LOC_Os09g31430.1 N frameshift_variant Average:75.059; most accessible tissue: Callus, score: 90.316 N N N N
vg0918906558 A -> DEL LOC_Os09g31430.2 N frameshift_variant Average:75.059; most accessible tissue: Callus, score: 90.316 N N N N
vg0918906558 A -> T LOC_Os09g31430.1 missense_variant ; p.Ser276Thr; MODERATE nonsynonymous_codon ; S276T Average:75.059; most accessible tissue: Callus, score: 90.316 unknown unknown TOLERATED 0.50
vg0918906558 A -> T LOC_Os09g31430.2 missense_variant ; p.Ser276Thr; MODERATE nonsynonymous_codon ; S276T Average:75.059; most accessible tissue: Callus, score: 90.316 unknown unknown TOLERATED 0.36

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918906558 A T 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918906558 NA 1.90E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 1.04E-23 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 3.86E-09 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 5.95E-23 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 6.84E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 1.80E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 6.40E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 3.16E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 9.22E-12 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 1.35E-08 mr1405_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 9.90E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 4.97E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 2.78E-17 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 8.79E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 1.07E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918906558 NA 3.30E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251