\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918496669:

Variant ID: vg0918496669 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18496669
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGTTAGTCACATATAAATTATTATTCATGTTTTATCATATAATAACAATAAAATACTAATCATTAAAATTTTTTAAATAAAACGAACGGTCAAAGTTG[G/A,T]
ACATGAACCATACAAAACTGTATTTATTTTAGGACGGATAGATGGAGTAATGATTTTTTTGAAAATTCATGGAATCGGATCAGAGTCACAGCTGGTCTTA

Reverse complement sequence

TAAGACCAGCTGTGACTCTGATCCGATTCCATGAATTTTCAAAAAAATCATTACTCCATCTATCCGTCCTAAAATAAATACAGTTTTGTATGGTTCATGT[C/T,A]
CAACTTTGACCGTTCGTTTTATTTAAAAAATTTTAATGATTAGTATTTTATTGTTATTATATGATAAAACATGAATAATAATTTATATGTGACTAACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 9.90% 0.72% 0.00% T: 0.08%
All Indica  2759 82.10% 16.70% 1.20% 0.00% T: 0.04%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 0.50% 1.51% 0.00% NA
Indica II  465 32.50% 64.70% 2.80% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 81.40% 17.00% 1.40% 0.00% T: 0.13%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 5.60% 1.11% 0.00% T: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918496669 G -> T LOC_Os09g30380.1 downstream_gene_variant ; 1529.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> T LOC_Os09g30390.1 downstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> T LOC_Os09g30400.1 downstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> T LOC_Os09g30400.2 downstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> T LOC_Os09g30400.3 downstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> T LOC_Os09g30390-LOC_Os09g30400 intergenic_region ; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> A LOC_Os09g30380.1 downstream_gene_variant ; 1529.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> A LOC_Os09g30390.1 downstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> A LOC_Os09g30400.1 downstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> A LOC_Os09g30400.2 downstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> A LOC_Os09g30400.3 downstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0918496669 G -> A LOC_Os09g30390-LOC_Os09g30400 intergenic_region ; MODIFIER silent_mutation Average:64.854; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918496669 G A -0.03 -0.03 -0.03 -0.03 -0.04 -0.04
vg0918496669 G T -0.02 -0.03 -0.03 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918496669 NA 1.65E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918496669 NA 6.62E-10 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 3.06E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 1.10E-07 NA mr1231 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 4.75E-09 1.26E-12 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 3.16E-09 2.47E-10 mr1232 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 2.08E-10 5.01E-13 mr1232 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 1.39E-07 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 9.33E-06 2.71E-07 mr1319 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 5.13E-06 mr1330 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 1.24E-08 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 3.47E-06 mr1332 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 1.60E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 4.85E-08 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 5.19E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 2.35E-14 5.66E-23 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 2.26E-15 4.81E-26 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 9.52E-11 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 4.19E-09 NA mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 7.89E-08 8.67E-14 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 4.20E-11 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 2.10E-06 NA mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 5.39E-07 1.69E-12 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 1.14E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 2.74E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 9.27E-06 6.45E-11 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 4.82E-06 4.54E-11 mr1232_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 1.19E-10 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 9.03E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 4.91E-14 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 4.33E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 5.79E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 2.25E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 1.41E-10 2.11E-24 mr1557_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 1.05E-10 4.24E-21 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 NA 1.85E-10 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 7.70E-14 NA mr1598_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918496669 3.28E-12 1.54E-23 mr1598_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251